Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 146 showing 2901 ~ 2920 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00028978

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00028978

Source Database: WormBase (WB)
Affected Genes: WBGene00003507(mut-14)
Genomic Alteration: WBGene00003507(mut-14)
Availability: available
Synonyms: mut-14(pk738)
Alternate IDs: WB-STRAIN:NL1838, CGC_NL1838
Notes: Mutator strain. TS. RNAi defect. TATTCTGGAC A AAGCTGATAA.

Proper citation: RRID:WB-STRAIN:WBStrain00028978 Copy   


  • RRID:WB-STRAIN:WBStrain00028979

http://www.wormbase.org/db/get?name=WBStrain00028979

Source Database: WormBase (WB)
Affected Genes: WBGene00011908(pash-1)
Genomic Alteration: WBGene00011908(pash-1)
Availability: available
Synonyms: pash-1(pk2083)/+ I; pkIs2084.
Alternate IDs: WB-STRAIN:NL1888, CGC_NL1888
Notes: pkIs2084 [col-10::LacZ::lin-41 + goa-1::GFP]. Heterozygous. pash-1(pk2083)/+ heterozygotes look wild-type and will segregate pash-1(pk2083)/+ heterozygotes, sterile pk2083 homozygotes, and wild-type. Pick wild-type heterozygotes and check for segregation of sterile progeny to maintain.

Proper citation: RRID:WB-STRAIN:WBStrain00028979 Copy   


  • RRID:WB-STRAIN:WBStrain00028975

http://www.wormbase.org/db/get?name=WBStrain00028975

Source Database: WormBase (WB)
Affected Genes: WBGene00003504(mut-7)
Genomic Alteration: WBGene00003504(mut-7)
Availability: available
Synonyms: mut-7(pk720) III.
Alternate IDs: WB-STRAIN:NL1820, CGC_NL1820
Notes: Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator.

Proper citation: RRID:WB-STRAIN:WBStrain00028975 Copy   


  • RRID:WB-STRAIN:WBStrain00028929

http://www.wormbase.org/db/get?name=WBStrain00028929

Source Database: WormBase (WB)
Affected Genes: WBGene00003185(mek-1)
Genomic Alteration: WBGene00003185(mek-1)
Availability: available
Synonyms: rde-3(r459) I; mek-1(pk97) X.
Alternate IDs: WB-STRAIN:NL737, CGC_NL737
Notes: K08A8.1 Previously called kin-17(pk97).

Proper citation: RRID:WB-STRAIN:WBStrain00028929 Copy   


  • RRID:WB-STRAIN:WBStrain00028920

http://www.wormbase.org/db/get?name=WBStrain00028920

Source Database: WormBase (WB)
Affected Genes: WBGene00004949(sox-2)
Genomic Alteration: WBGene00004949(sox-2)
Availability: available
Synonyms: rde-3(r459) I; sox-2(pk65).
Alternate IDs: WB-STRAIN:NL713, CGC_NL713
Notes: K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT.|"Made_by: M Vroomen"

Proper citation: RRID:WB-STRAIN:WBStrain00028920 Copy   


  • RRID:WB-STRAIN:WBStrain00028914

http://www.wormbase.org/db/get?name=WBStrain00028914

Source Database: WormBase (WB)
Affected Genes: WBGene00000939(dcr-1)
Genomic Alteration: WBGene00000939(dcr-1)
Availability: available
Synonyms: dcr-1(pk1351)/+ III.
Alternate IDs: WB-STRAIN:NL687, CGC_NL687
Notes: Heterozygotes are WT and segregate WT and animals with protruding vulvas (dcr-1 homozygotes).|"Made_by: Fischer/Thijssen"|"Mutagen:UV/TMP"|"no longer available from the CGC."

Proper citation: RRID:WB-STRAIN:WBStrain00028914 Copy   


  • RRID:WB-STRAIN:WBStrain00028916

http://www.wormbase.org/db/get?name=WBStrain00028916

Source Database: WormBase (WB)
Affected Genes: WBGene00000292(cap-1)
Genomic Alteration: WBGene00000292(cap-1)
Availability: available
Synonyms: rde-3(r459) cap-1(pk56::Tc1) I.
Alternate IDs: WB-STRAIN:NL706, CGC_NL706
Notes: Made_by M. Vroomen|"Made_by: M. Vroomen"

Proper citation: RRID:WB-STRAIN:WBStrain00028916 Copy   


  • RRID:WB-STRAIN:WBStrain00028998

http://www.wormbase.org/db/get?name=WBStrain00028998

Source Database: WormBase (WB)
Affected Genes: WBGene00001675(gpa-13)
Genomic Alteration: WBGene00001675(gpa-13)
Availability: available
Source References: PMID:10192394
Synonyms: gpa-13(pk1270) V.
Alternate IDs: WB-STRAIN:NL2330, CGC_NL2330
Notes: Made_by:

Proper citation: RRID:WB-STRAIN:WBStrain00028998 Copy   


  • RRID:WB-STRAIN:WBStrain00028911

http://www.wormbase.org/db/get?name=WBStrain00028911

Source Database: WormBase (WB)
Affected Genes: WBGene00001674(gpa-12)
Genomic Alteration: WBGene00001674(gpa-12)
Availability: available
Source References: PMID:10192394, PMID:37527037
Synonyms: gpa-12(pk322) X.
Alternate IDs: WB-STRAIN:NL594, CGC_NL594
Notes: Deletion sequence: Flanking undeleted sequence in uppercase, deleted sequence in lower case: CGGTGAATCTggaaagtccacg . . . aaatgcttatTCACAATGTT .

Proper citation: RRID:WB-STRAIN:WBStrain00028911 Copy   


  • RRID:WB-STRAIN:WBStrain00028999

http://www.wormbase.org/db/get?name=WBStrain00028999

Source Database: WormBase (WB)
Affected Genes: WBGene00000253(bli-3)|WBGene00001678(gpa-16)
Genomic Alteration: WBGene00000253(bli-3), WBGene00001678(gpa-16)
Availability: available
Synonyms: gpa-16(pk481)/bli-3(e767) I.
Alternate IDs: WB-STRAIN:NL2331, CGC_NL2331
Notes: Heterozygotes are WT and segregate WT, blistered, and lethals. pk481 previously called spn-1.

Proper citation: RRID:WB-STRAIN:WBStrain00028999 Copy   


  • RRID:WB-STRAIN:WBStrain00028994

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00028994

Source Database: WormBase (WB)
Affected Genes: WBGene00004508(rrf-1)
Genomic Alteration: WBGene00004508(rrf-1)
Availability: available
Source References: PMID:31717869, PMID:32943454, PMID:33289480, PMID:33319173, PMID:33594200, PMID:34449775
Synonyms: rrf-1(pk1417) I.
Alternate IDs: WB-STRAIN:NL2098, CGC_NL2098
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"Homozygous rrf-1 deletion allele. RNAi interference for genes expressed in somatic tissue is lost in rrf-1 deletion mutants."|"Mutagen:UV/TMP"|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"WBStrain mapped, WBPaper00060738 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060343 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060797 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061852 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00028994 Copy   


  • RRID:WB-STRAIN:WBStrain00029001

http://www.wormbase.org/db/get?name=WBStrain00029001

Source Database: WormBase (WB)
Affected Genes: WBGene00003422(msh-6)
Genomic Alteration: WBGene00003422(msh-6)
Availability: available
Synonyms: msh-6(pk2504) I.
Alternate IDs: WB-STRAIN:NL2511, CGC_NL2511
Notes: Mutator phenotype. Enhanced level of spontaneous mutations (frameshifts and single base pair substitutions). The genomic region that is deleted in NL2511 is from nt 24180-25956 (takes out exon 5 and part of exon 6).

Proper citation: RRID:WB-STRAIN:WBStrain00029001 Copy   


  • RRID:WB-STRAIN:WBStrain00028948

http://www.wormbase.org/db/get?name=WBStrain00028948

Source Database: WormBase (WB)
Affected Genes: WBGene00001079(dpy-20)
Genomic Alteration: WBGene00001079(dpy-20)
Availability: available
Source References: PMID:10192394
Synonyms: dpy-20(e1282) IV; pkIs379.
Alternate IDs: WB-STRAIN:NL1140, CGC_NL1140
Notes: pkIs379 [gpa-5XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.

Proper citation: RRID:WB-STRAIN:WBStrain00028948 Copy   


  • RRID:WB-STRAIN:WBStrain00028949

http://www.wormbase.org/db/get?name=WBStrain00028949

Source Database: WormBase (WB)
Affected Genes: WBGene00001670(gpa-8)
Genomic Alteration: WBGene00001670(gpa-8)
Availability: available
Source References: PMID:10192394
Synonyms: gpa-8(pk345) V.
Alternate IDs: WB-STRAIN:NL1142, CGC_NL1142
Notes: Made_by:

Proper citation: RRID:WB-STRAIN:WBStrain00028949 Copy   


  • RRID:WB-STRAIN:WBStrain00028943

http://www.wormbase.org/db/get?name=WBStrain00028943

Source Database: WormBase (WB)
Affected Genes: WBGene00000395(cdh-3)
Genomic Alteration: WBGene00000395(cdh-3)
Availability: available
Source References: PMID:9012534
Synonyms: cdh-3(pk87) III.
Alternate IDs: WB-STRAIN:NL1000, CGC_NL1000
Notes: 2.6 kb deletion. pk87 homozygotes have a variable defect in hyp10 morphogenesis; most obvious in L1-L2 larvae. Rescued by WT copy of cdh-3 present on cosmid ZK112.|"mut-2 background"

Proper citation: RRID:WB-STRAIN:WBStrain00028943 Copy   


  • RRID:WB-STRAIN:WBStrain00028944

http://www.wormbase.org/db/get?name=WBStrain00028944

Source Database: WormBase (WB)
Affected Genes: WBGene00004182(prk-1)
Genomic Alteration: WBGene00004182(prk-1)
Availability: available
Synonyms: rde-3(r459) I; prk-1(pk86::Tc1) III.
Alternate IDs: WB-STRAIN:NL1100, CGC_NL1100
Notes: Insertion in CCTTCAGAAG TA TGTCATTTGG.

Proper citation: RRID:WB-STRAIN:WBStrain00028944 Copy   


  • RRID:WB-STRAIN:WBStrain00028945

http://www.wormbase.org/db/get?name=WBStrain00028945

Source Database: WormBase (WB)
Affected Genes: WBGene00004183(prk-2)
Genomic Alteration: WBGene00004183(prk-2)
Availability: available
Synonyms: prk-2(pk278) III.
Alternate IDs: WB-STRAIN:NL1106, CGC_NL1106
Notes: Deletion between: (exon 2): CCCAGAAGGCTT and (intron 4): ATATATATATATAGAC (complex rearrangement in between).

Proper citation: RRID:WB-STRAIN:WBStrain00028945 Copy   


  • RRID:WB-STRAIN:WBStrain00028946

http://www.wormbase.org/db/get?name=WBStrain00028946

Source Database: WormBase (WB)
Affected Genes: WBGene00001667(gpa-5)
Genomic Alteration: WBGene00001667(gpa-5)
Availability: available
Synonyms: rde-3(r459) I; gpa-5(pk375) X.
Alternate IDs: WB-STRAIN:NL1136, CGC_NL1136
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00028946 Copy   


  • RRID:WB-STRAIN:WBStrain00028940

http://www.wormbase.org/db/get?name=WBStrain00028940

Source Database: WormBase (WB)
Affected Genes: WBGene00000539(cln-3.1)
Genomic Alteration: WBGene00000539(cln-3.1)
Availability: available
Synonyms: cln-3.1(pk479).
Alternate IDs: WB-STRAIN:NL796, CGC_NL796
Notes: F07B10.1 TAAACAACTT GATCCAATTC. Df.

Proper citation: RRID:WB-STRAIN:WBStrain00028940 Copy   


  • RRID:WB-STRAIN:WBStrain00028936

http://www.wormbase.org/db/get?name=WBStrain00028936

Source Database: WormBase (WB)
Affected Genes: WBGene00004183(prk-2)
Genomic Alteration: WBGene00004183(prk-2)
Availability: available
Synonyms: prk-2(pk439) I.
Alternate IDs: WB-STRAIN:NL791, CGC_NL791
Notes: Homozygous prk-2 deletion allele.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00028936 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X