Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Rag1/Rag2em1MlitIl2rgem1Mlit-/y Resource Report Resource Website |
RRID:RGD_38548916 | Rattus norvegicus | The Rag1, Rag2, and Il2rg triple-knockout rats were obtained by intercrossing Rag1 and Rag2 double-knockout rat (RGD:38548914) with Il2rg knockout rat (RGD:38548915). | 38548916 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38548916 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
LE-Dyrk1aem3Mcwi Resource Report Resource Website |
RRID:RGD_25394526 | Rattus norvegicus | The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 5-bp deletion in exon 3 of the gene. Autism Rat Model Resource. Contact MCW rat distribution at [email protected] | 25394526 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 25394526 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
SD-Cyp2c11em1Nju Resource Report Resource Website |
RRID:RGD_150429707 | Rattus norvegicus | CRISPR/Cas9 system containing two pairs of single guide RNA (sgRNA) primers: sgRNA1 (forward primer: 59-GCTACTG- TAACTGACATGTT-39; reverse primer: 59-AACATGTCAGTTACAGTAGC- 39) and sgRNA2 (forward primer: 59-TCAAGGGTAAACTCAGACTG-39; reverse primer: 59-CAGTCTGAGTTTACCCTTGA-39), was injected to Sprague-Dawley rat one-cell embryos. The F0 pups were screened by genomic DNA sequencing to identify heterozygous CYP2C11+/2 founders.This mutant strain carries a two base pairs (GT) insertion into exon 6 of CYP2C11 and resulting in the knockout allele. | 150429707 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150429707 | RGD | 2026-09-26 02:42:12 | 0 | |||||
|
BBDR/RhwMcwi Resource Report Resource Website |
RRID:RGD_41412170 | Rattus norvegicus | This strain was given to Medical College of Wisconsin by Ake Lernmark and maintained there. | 41412170 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 41412170 | RGD | 2026-09-26 02:42:12 | 0 | |||||
|
MWF/Ztm Resource Report Resource Website |
RRID:RGD_25314294 | Rattus norvegicus | Fromter selected from outbred Munich-Wistar rats for large numbers of superficial glomeruli. | 25314294 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 25314294 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
GK/Jpe Resource Report Resource Website |
RRID:RGD_41404660 | Rattus norvegicus | The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.Until the end of 1980s, | 41404660 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 41404660 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
LE-Cyfip1em1Sage+/- Resource Report Resource Website |
RRID:RGD_14985210 | Rattus norvegicus | The bioinformatics software (Horizon Discovery, St. Louis, USA) was used to design a short guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1).sgRNA-Cas9 was performed by nucleofecting the sgRNA-Cas9 into rat C6 glial cells. Genomic DNA (gDNA) PCR products were subsequently generated from nucleofected C6 cells using primers flanking the sgRNA site (FOR: GCCAAAGCTTCCCCTAAAGT; REV: TGGGCGTCAAGTACATTCTG; 497bp amplicon). Embryos were collected from donor female Long Evans rats and injected with the validated sgRNA-Cas9. Then implanted into synchronized pseudopregnant Long Evans recipient female This mutant carries 4bp out of frame heterozygous deletion in exon 7 of the Cyfip1, resulting bioinformatics prediction of an early stop codon in exon 8. | 14985210 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14985210 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
W/Jpe Resource Report Resource Website |
RRID:RGD_41404661 | Rattus norvegicus | Inbred Wistar rats maintained at Center for Neurosciences and Cell Biology of Coimbra, University of Coimbra, Coimbra, Portugal | 41404661 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 41404661 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
SD-Dnmt1tm1(Myh6-cre)Cqin Resource Report Resource Website 1+ mentions |
RRID:RGD_126925139 | Rattus norvegicus | To specifically knockout Dnmt1 in the myocardium, Cre-loxP system was used by crossing alpha -MHC-Cre rats with Dnmt1 cKO rats. Dnmt1+/- offspring positive for the alpha MHC-Cre transgene (double-positive) were selected. In the second round of crossbreeding, the double-positive rats were crossed with Dnmt1 cKO rats, and Dnmt1-/- offspring positive for the alpha MHC-Cre transgene were obtained as myocardium-specific Dnmt1-KO rats | 126925139 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126925139 | RGD | 2026-09-26 02:42:13 | 1 | |||||
|
LEW-Tg(HLA-B*2705,B2M)Tg/021-3Reh Resource Report Resource Website |
RRID:RGD_35668861 | Rattus norvegicus | This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 20 copies of HLA-B*2705 and 15 copies of the human beta-2-microglobulin gene. | 35668861 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 35668861 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
SHRSP.SHR-(rs198233821-rs198932221)/Utx Resource Report Resource Website |
RRID:RGD_150429760 | Rattus norvegicus | A congenic strain made by introducing IgH haplotype block (a segment of chr6:146,030,387 to 154,214,590 ,Rn5 assembly of the rat genome). from SHR-B2 (SHR/Utx) into SHR-A3 (SHRSP/BbbUtx). The igH block contains sequences that are highly divergent between of SHR-A3 and SHR-B2 . | 150429760 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 150429760 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
SD-Lrp5em3Vari Resource Report Resource Website |
RRID:RGD_41404651 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce an inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos. | 41404651 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 41404651 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
WI.SD-PcloTn(sb-B-Geo)Fkh Resource Report Resource Website |
RRID:RGD_41408339 | Rattus norvegicus | The Sprague-Dawley transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rat background. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame. | 41408339 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 41408339 | RGD | 2026-09-26 02:42:12 | 0 | |||||
|
SD-Tg(Prnp-LacZ/EGFP)12084 Resource Report Resource Website |
RRID:RGD_15045605 | Rattus norvegicus | This transgenic strain line 12084 carries the dual-reporter LacZ/EGFP (enhanced green fluorescent protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgenes were driven by rat Prnp promoter. | 15045605 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 15045605 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
SD-Tg(Prnp-Prnp)2919 Resource Report Resource Website |
RRID:RGD_15045607 | Rattus norvegicus | This transgenic strain line Tg2919 carries the open reading frame of rat Prnp (prion protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgene were driven by rat Prnp promoter. | 15045607 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 15045607 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
F344-Tg(Cx3cr1-cre/ERT2)3Ottc Resource Report Resource Website |
RRID:RGD_38508891 | Rattus norvegicus | The transgene of LE-Tg(Cx3cr1-cre)3Ottc (RGD: 13441557) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of transgene. The donor LE transgenic was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter. | 38508891 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 38508891 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
RCCHan:WIST Resource Report Resource Website 1+ mentions |
RRID:RGD_149735906 | Rattus norvegicus | Wistar Hannover rats are derived from the Han:WIST strain from the Zentral Institut fur Versuchstierzucht (ZfV) (Hannover, Germany). In 1989, 156 pairs were introduced from ZfV to the Institute for Biomedical Research (IBM) in Switzerland (IBM underwent a structural change [name change] to BRL Ltd. and RCC Ltd.) | 149735906 | outbred | Rat Genome Database (RGD) | RGD | Unknown | 149735906 | RGD | 2026-09-26 02:42:12 | 4 | |||||
|
SD-Lrp5em1Vari Resource Report Resource Website |
RRID:RGD_41404646 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos. | 41404646 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 41404646 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
F344.LE-ROSA26 em1(LTR-nLuc)Ottc Resource Report Resource Website |
RRID:RGD_38508893 | Rattus norvegicus | The mutated ROSA26 locus of LE-(ROSA)26 em1(LTR-nLuc)Ottc (RGD:13208223) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of mutated locus. The LE donor is CRISPR/Case9 knock-in strain that has cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. | 38508893 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38508893 | RGD | 2026-09-26 02:42:13 | 0 | |||||
|
Iar:WIC Resource Report Resource Website |
RRID:RGD_125097496 | Rattus norvegicus | Institute for Animal Reproduction in Japan | 125097496 | outbred | Rat Genome Database (RGD) | RGD | Unknown | 125097496 | RGD | 2026-09-26 02:42:13 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
