SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Authority Record Last Update Mentions Count
DA449
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005460 Caenorhabditis elegans eat-1(e2343) dpy-20(e1282) IV. Thin, starved, healthy adults. Retain few eggs. Slow irregular pumping at 16, 20, 25C. Dpy. WBGene00001079(dpy-20)|WBGene00044731(eat-1) WBGene00001079(dpy-20), WBGene00044731(eat-1) WB-STRAIN:WBStrain00005460 WormBase (WB) WB available PMID:8462849 WB-STRAIN:DA449, CGC_DA449 WormBase 2026-09-19 11:00:39 0
DA438
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005458 Caenorhabditis elegans bli-4(e937) I; rol-6(e187) II; daf-2(e1368) vab-7(e1562) III; unc-31(e928) IV; dpy-11(e224) V; lon-2(e678) X. Linkage mapping strain. Maintain at 15C. WBGene00000254(bli-4)|WBGene00000898(daf-2)|WBGene00001073(dpy-11)|WBGene00003056(lon-2)|WBGene00004397(rol-6)|WBGene00006767(unc-31)|WBGene00006873(vab-7) WBGene00000254(bli-4), WBGene00000898(daf-2), WBGene00001073(dpy-11), WBGene00003056(lon-2), WBGene00004397(rol-6), WBGene00006767(unc-31), WBGene00006873(vab-7) WB-STRAIN:WBStrain00005458 WormBase (WB) WB available WB-STRAIN:DA438, CGC_DA438 WormBase 2026-09-19 11:00:39 0
DA443
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005459 Caenorhabditis elegans rol-3(e754) unc-42(e270) V. Roller Unc. e754 is cold-sensitive: lethal at 15C. WBGene00004395(rol-3)|WBGene00006778(unc-42) WBGene00004395(rol-3), WBGene00006778(unc-42) WB-STRAIN:WBStrain00005459 WormBase (WB) WB available WB-STRAIN:DA443, CGC_DA443 WormBase 2026-09-19 11:00:39 0
CZ24990
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005456 Caenorhabditis elegans unc-44(ju1412[unc-44::GFP]) IV. Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.|"Supplementary_genotype unc-44(ju1412[unc-44::GFP]) (IV)" WBGene00006780(unc-44) WBGene00006780(unc-44) WB-STRAIN:WBStrain00005456 WormBase (WB) WB available PMID:37751746 WB-STRAIN:CZ24990, CGC_CZ24990 WormBase 2026-09-19 11:00:39 0
CZ23281
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005454 Caenorhabditis elegans juEx7105. juEx7105 [mec-4p::PH::miniSOG(Q103L) + mec-4p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in mechanosensory neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. WB-STRAIN:WBStrain00005454 WormBase (WB) WB available WB-STRAIN:CZ23281, CGC_CZ23281 WormBase 2026-09-19 11:00:39 0
DA2155
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005596 Caenorhabditis elegans har-1(ad2155) III. Hemiasterlin resistant. Maintain under normal conditions. Reference: Zubovych IO, et al. Mol Biol Cell. 2010 Mar 15;21(6):956-69. WBGene00007630(har-1) WBGene00007630(har-1) WB-STRAIN:WBStrain00005596 WormBase (WB) WB available WB-STRAIN:DA2155, CGC_DA2155 WormBase 2026-09-19 11:00:41 0
DA2143
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005593 Caenorhabditis elegans egl-4(ks62) IV; adEx2143. adEx2143 [tax-4p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. pkg-1 is the new name of egl-4. Reference: You et al (2008) Cell Metab 7(3):249-57. WBGene00001173(egl-4) WBGene00001173(egl-4) WB-STRAIN:WBStrain00005593 WormBase (WB) WB available WB-STRAIN:DA2143, CGC_DA2143 WormBase 2026-09-19 11:00:41 0
DA2100
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00005590 Caenorhabditis elegans ser-7(tm1325) X Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00060976 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060405 paper added based on AFP_Strain data." WBGene00004780(ser-7) WBGene00004780(ser-7) WB-STRAIN:WBStrain00005590 WormBase (WB) WB available PMID:33007049
PMID:38514005
PMID:39025433
WB-STRAIN:DA2100, CGC_DA2100 WormBase 2026-09-19 11:00:41 1
DA726
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005509 Caenorhabditis elegans unc-10(e102) eat-13(ad522) X. Unc. Eat mutant. Slippery pharynx-Slight relaxation defect. WBGene00001142(eat-13)|WBGene00006750(unc-10) WBGene00001142(eat-13), WBGene00006750(unc-10) WB-STRAIN:WBStrain00005509 WormBase (WB) WB available PMID:8462849 WB-STRAIN:DA726, CGC_DA726 WormBase 2026-09-19 11:00:40 0
DA707
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005506 Caenorhabditis elegans eat-17(ad707) X. Eat mutant. Stuffs corpus and isthmus. Abnormality in m6 and m7 contraction timing. Displays clumping behavior; isolated in an RC301 background, so it's likely to have the RC301 bor-1 mutation. WBGene00020770(eat-17) WBGene00020770(eat-17) WB-STRAIN:WBStrain00005506 WormBase (WB) WB available PMID:8462849 WB-STRAIN:DA707, CGC_DA707 WormBase 2026-09-19 11:00:40 0
DA698
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005504 Caenorhabditis elegans unc-36(ad698) III. EMS - RC301 background|"Unc. Eat - slippery pharynx, slow pumping." WBGene00006772(unc-36) WBGene00006772(unc-36) WB-STRAIN:WBStrain00005504 WormBase (WB) WB available PMID:38338915 WB-STRAIN:DA698, CGC_DA698 WormBase 2026-09-19 11:00:40 0
DA686
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005502 Caenorhabditis elegans nDf16/qC1 [dpy-19(e1259) glp-1(q339)] III. Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. dpy-19(e1259) is temperature sensitive. Maintain by picking WT. [Checked 11/94 with sma-3 and nDf16 is present.]|"Mutagen:Gamma rays (nDf16)" WBGene00001078(dpy-19)|WBGene00001609(glp-1) WBGene00001078(dpy-19), WBGene00001609(glp-1) WB-STRAIN:WBStrain00005502 WormBase (WB) WB available PMID:2401010 WB-STRAIN:DA686, CGC_DA686 WormBase 2026-09-19 11:00:40 0
DA2038
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005589 Caenorhabditis elegans EMPTY EMPTY WBGene00003514(myo-2) WBGene00003514(myo-2) WB-STRAIN:WBStrain00005589 WormBase (WB) WB unknown WB-STRAIN:DA2038 WormBase 2026-09-19 11:00:41 0
DA1774
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005587 Caenorhabditis elegans ser-3(ad1774) I. Deletion of bp 433-1994 of K02F2.6.|"Made_by: T. Niacaris"|"Mutagen:UV/TMP" WBGene00004778(ser-3) WBGene00004778(ser-3) WB-STRAIN:WBStrain00005587 WormBase (WB) WB available WB-STRAIN:DA1774, CGC_DA1774 WormBase 2026-09-19 11:00:41 0
DA820
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005519 Caenorhabditis elegans eat-18(ad820) I. Semidominant Eat. pka eat-18. WBGene00001147(eat-18) WBGene00001147(eat-18) WB-STRAIN:WBStrain00005519 WormBase (WB) WB available WB-STRAIN:DA820, CGC_DA820 WormBase 2026-09-19 11:00:40 0
DA819
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005518 Caenorhabditis elegans eat-4(ad819) III. Abnormal feeding. WBGene00001135(eat-4) WBGene00001135(eat-4) WB-STRAIN:WBStrain00005518 WormBase (WB) WB available PMID:8462849 WB-STRAIN:DA819, CGC_DA819 WormBase 2026-09-19 11:00:40 0
DA792
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005516 Caenorhabditis elegans eat-6(ad792) V. Eat. Relaxation defective. Lib. Cold sensitive. WBGene00001137(eat-6) WBGene00001137(eat-6) WB-STRAIN:WBStrain00005516 WormBase (WB) WB available WB-STRAIN:DA792, CGC_DA792 WormBase 2026-09-19 11:00:40 0
DA734
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005511 Caenorhabditis elegans adDf538 unc-101(m1) I. Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. Unc. adDf538 previously called phm-2(ad538). WBGene00006829(unc-101) WBGene00006829(unc-101) WB-STRAIN:WBStrain00005511 WormBase (WB) WB available PMID:8462849 WB-STRAIN:DA734, CGC_DA734 WormBase 2026-09-19 11:00:40 0
DA2250
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00005599 Caenorhabditis elegans mgl-2(tm355) I; mgl-1(tm1811) X. Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7. WBGene00003232(mgl-1)|WBGene00003233(mgl-2) WBGene00003232(mgl-1), WBGene00003233(mgl-2) WB-STRAIN:WBStrain00005599 WormBase (WB) WB available PMID:38362034 WB-STRAIN:DA2250, CGC_DA2250 WormBase 2026-09-19 11:00:41 6
DA2202
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00005597 Caenorhabditis elegans daf-7(e1372) III; adEx2202. adEx2202 [gpa-4p::daf-7 + rol-6p::GFP]. Rescues Daf-c. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57. WBGene00000903(daf-7) WBGene00000903(daf-7) WB-STRAIN:WBStrain00005597 WormBase (WB) WB available WB-STRAIN:DA2202, CGC_DA2202 WormBase 2026-09-19 11:00:41 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.