Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00005460
Source Database: WormBase (WB)
Affected Genes: WBGene00001079(dpy-20)|WBGene00044731(eat-1)
Genomic Alteration: WBGene00001079(dpy-20), WBGene00044731(eat-1)
Availability: available
Source References: PMID:8462849
Synonyms: eat-1(e2343) dpy-20(e1282) IV.
Alternate IDs: WB-STRAIN:DA449, CGC_DA449
Notes: Thin, starved, healthy adults. Retain few eggs. Slow irregular pumping at 16, 20, 25C. Dpy.
Proper citation: RRID:WB-STRAIN:WBStrain00005460 Copy
http://www.wormbase.org/db/get?name=WBStrain00005458
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00000898(daf-2)|WBGene00001073(dpy-11)|WBGene00003056(lon-2)|WBGene00004397(rol-6)|WBGene00006767(unc-31)|WBGene00006873(vab-7)
Genomic Alteration: WBGene00000254(bli-4), WBGene00000898(daf-2), WBGene00001073(dpy-11), WBGene00003056(lon-2), WBGene00004397(rol-6), WBGene00006767(unc-31), WBGene00006873(vab-7)
Availability: available
Synonyms: bli-4(e937) I; rol-6(e187) II; daf-2(e1368) vab-7(e1562) III; unc-31(e928) IV; dpy-11(e224) V; lon-2(e678) X.
Alternate IDs: WB-STRAIN:DA438, CGC_DA438
Notes: Linkage mapping strain. Maintain at 15C.
Proper citation: RRID:WB-STRAIN:WBStrain00005458 Copy
http://www.wormbase.org/db/get?name=WBStrain00005459
Source Database: WormBase (WB)
Affected Genes: WBGene00004395(rol-3)|WBGene00006778(unc-42)
Genomic Alteration: WBGene00004395(rol-3), WBGene00006778(unc-42)
Availability: available
Synonyms: rol-3(e754) unc-42(e270) V.
Alternate IDs: WB-STRAIN:DA443, CGC_DA443
Notes: Roller Unc. e754 is cold-sensitive: lethal at 15C.
Proper citation: RRID:WB-STRAIN:WBStrain00005459 Copy
http://www.wormbase.org/db/get?name=WBStrain00005456
Source Database: WormBase (WB)
Affected Genes: WBGene00006780(unc-44)
Genomic Alteration: WBGene00006780(unc-44)
Availability: available
Source References: PMID:37751746
Synonyms: unc-44(ju1412[unc-44::GFP]) IV.
Alternate IDs: WB-STRAIN:CZ24990, CGC_CZ24990
Notes: Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.|"Supplementary_genotype unc-44(ju1412[unc-44::GFP]) (IV)"
Proper citation: RRID:WB-STRAIN:WBStrain00005456 Copy
http://www.wormbase.org/db/get?name=WBStrain00005454
Source Database: WormBase (WB)
Availability: available
Synonyms: juEx7105.
Alternate IDs: WB-STRAIN:CZ23281, CGC_CZ23281
Notes: juEx7105 [mec-4p::PH::miniSOG(Q103L) + mec-4p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in mechanosensory neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
Proper citation: RRID:WB-STRAIN:WBStrain00005454 Copy
http://www.wormbase.org/db/get?name=WBStrain00005596
Source Database: WormBase (WB)
Affected Genes: WBGene00007630(har-1)
Genomic Alteration: WBGene00007630(har-1)
Availability: available
Synonyms: har-1(ad2155) III.
Alternate IDs: WB-STRAIN:DA2155, CGC_DA2155
Notes: Hemiasterlin resistant. Maintain under normal conditions. Reference: Zubovych IO, et al. Mol Biol Cell. 2010 Mar 15;21(6):956-69.
Proper citation: RRID:WB-STRAIN:WBStrain00005596 Copy
http://www.wormbase.org/db/get?name=WBStrain00005593
Source Database: WormBase (WB)
Affected Genes: WBGene00001173(egl-4)
Genomic Alteration: WBGene00001173(egl-4)
Availability: available
Synonyms: egl-4(ks62) IV; adEx2143.
Alternate IDs: WB-STRAIN:DA2143, CGC_DA2143
Notes: adEx2143 [tax-4p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. pkg-1 is the new name of egl-4. Reference: You et al (2008) Cell Metab 7(3):249-57.
Proper citation: RRID:WB-STRAIN:WBStrain00005593 Copy
http://www.wormbase.org/db/get?name=WBStrain00005590
Source Database: WormBase (WB)
Affected Genes: WBGene00004780(ser-7)
Genomic Alteration: WBGene00004780(ser-7)
Availability: available
Source References: PMID:33007049, PMID:38514005, PMID:39025433
Synonyms: ser-7(tm1325) X
Alternate IDs: WB-STRAIN:DA2100, CGC_DA2100
Notes: Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00060976 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060405 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005590 Copy
http://www.wormbase.org/db/get?name=WBStrain00005509
Source Database: WormBase (WB)
Affected Genes: WBGene00001142(eat-13)|WBGene00006750(unc-10)
Genomic Alteration: WBGene00001142(eat-13), WBGene00006750(unc-10)
Availability: available
Source References: PMID:8462849
Synonyms: unc-10(e102) eat-13(ad522) X.
Alternate IDs: WB-STRAIN:DA726, CGC_DA726
Notes: Unc. Eat mutant. Slippery pharynx-Slight relaxation defect.
Proper citation: RRID:WB-STRAIN:WBStrain00005509 Copy
http://www.wormbase.org/db/get?name=WBStrain00005506
Source Database: WormBase (WB)
Affected Genes: WBGene00020770(eat-17)
Genomic Alteration: WBGene00020770(eat-17)
Availability: available
Source References: PMID:8462849
Synonyms: eat-17(ad707) X.
Alternate IDs: WB-STRAIN:DA707, CGC_DA707
Notes: Eat mutant. Stuffs corpus and isthmus. Abnormality in m6 and m7 contraction timing. Displays clumping behavior; isolated in an RC301 background, so it's likely to have the RC301 bor-1 mutation.
Proper citation: RRID:WB-STRAIN:WBStrain00005506 Copy
http://www.wormbase.org/db/get?name=WBStrain00005504
Source Database: WormBase (WB)
Affected Genes: WBGene00006772(unc-36)
Genomic Alteration: WBGene00006772(unc-36)
Availability: available
Source References: PMID:38338915
Synonyms: unc-36(ad698) III.
Alternate IDs: WB-STRAIN:DA698, CGC_DA698
Notes: EMS - RC301 background|"Unc. Eat - slippery pharynx, slow pumping."
Proper citation: RRID:WB-STRAIN:WBStrain00005504 Copy
http://www.wormbase.org/db/get?name=WBStrain00005502
Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1)
Availability: available
Source References: PMID:2401010
Synonyms: nDf16/qC1 [dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:DA686, CGC_DA686
Notes: Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. dpy-19(e1259) is temperature sensitive. Maintain by picking WT. [Checked 11/94 with sma-3 and nDf16 is present.]|"Mutagen:Gamma rays (nDf16)"
Proper citation: RRID:WB-STRAIN:WBStrain00005502 Copy
http://www.wormbase.org/db/get?name=WBStrain00005589
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)
Genomic Alteration: WBGene00003514(myo-2)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:DA2038
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005589 Copy
http://www.wormbase.org/db/get?name=WBStrain00005587
Source Database: WormBase (WB)
Affected Genes: WBGene00004778(ser-3)
Genomic Alteration: WBGene00004778(ser-3)
Availability: available
Synonyms: ser-3(ad1774) I.
Alternate IDs: WB-STRAIN:DA1774, CGC_DA1774
Notes: Deletion of bp 433-1994 of K02F2.6.|"Made_by: T. Niacaris"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00005587 Copy
http://www.wormbase.org/db/get?name=WBStrain00005519
Source Database: WormBase (WB)
Affected Genes: WBGene00001147(eat-18)
Genomic Alteration: WBGene00001147(eat-18)
Availability: available
Synonyms: eat-18(ad820) I.
Alternate IDs: WB-STRAIN:DA820, CGC_DA820
Notes: Semidominant Eat. pka eat-18.
Proper citation: RRID:WB-STRAIN:WBStrain00005519 Copy
http://www.wormbase.org/db/get?name=WBStrain00005518
Source Database: WormBase (WB)
Affected Genes: WBGene00001135(eat-4)
Genomic Alteration: WBGene00001135(eat-4)
Availability: available
Source References: PMID:8462849
Synonyms: eat-4(ad819) III.
Alternate IDs: WB-STRAIN:DA819, CGC_DA819
Notes: Abnormal feeding.
Proper citation: RRID:WB-STRAIN:WBStrain00005518 Copy
http://www.wormbase.org/db/get?name=WBStrain00005516
Source Database: WormBase (WB)
Affected Genes: WBGene00001137(eat-6)
Genomic Alteration: WBGene00001137(eat-6)
Availability: available
Synonyms: eat-6(ad792) V.
Alternate IDs: WB-STRAIN:DA792, CGC_DA792
Notes: Eat. Relaxation defective. Lib. Cold sensitive.
Proper citation: RRID:WB-STRAIN:WBStrain00005516 Copy
http://www.wormbase.org/db/get?name=WBStrain00005511
Source Database: WormBase (WB)
Affected Genes: WBGene00006829(unc-101)
Genomic Alteration: WBGene00006829(unc-101)
Availability: available
Source References: PMID:8462849
Synonyms: adDf538 unc-101(m1) I.
Alternate IDs: WB-STRAIN:DA734, CGC_DA734
Notes: Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. Unc. adDf538 previously called phm-2(ad538).
Proper citation: RRID:WB-STRAIN:WBStrain00005511 Copy
http://www.wormbase.org/db/get?name=WBStrain00005599
Source Database: WormBase (WB)
Affected Genes: WBGene00003232(mgl-1)|WBGene00003233(mgl-2)
Genomic Alteration: WBGene00003232(mgl-1), WBGene00003233(mgl-2)
Availability: available
Source References: PMID:38362034
Synonyms: mgl-2(tm355) I; mgl-1(tm1811) X.
Alternate IDs: WB-STRAIN:DA2250, CGC_DA2250
Notes: Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7.
Proper citation: RRID:WB-STRAIN:WBStrain00005599 Copy
http://www.wormbase.org/db/get?name=WBStrain00005597
Source Database: WormBase (WB)
Affected Genes: WBGene00000903(daf-7)
Genomic Alteration: WBGene00000903(daf-7)
Availability: available
Synonyms: daf-7(e1372) III; adEx2202.
Alternate IDs: WB-STRAIN:DA2202, CGC_DA2202
Notes: adEx2202 [gpa-4p::daf-7 + rol-6p::GFP]. Rescues Daf-c. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57.
Proper citation: RRID:WB-STRAIN:WBStrain00005597 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.