Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SS-Slc7a9em1Mcwi Resource Report Resource Website |
RRID:RGD_7364881 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 6. | 7364881 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 7364881 | 2026-09-05 06:52:33 | 0 | |||||
|
SS-Sorcs2em1Mcwi Resource Report Resource Website |
RRID:RGD_7364882 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp frameshift deletion in exon 15. | 7364882 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 7364882 | 2026-09-05 06:52:33 | 0 | |||||
|
SS-Cst3em1Mcwi Resource Report Resource Website |
RRID:RGD_7364880 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1. | 7364880 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 7364880 | 2026-09-05 06:52:33 | 0 | |||||
|
LE-Park7em1Sage-/- Resource Report Resource Website |
RRID:RGD_7241055 | Rattus norvegicus | ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 (TTGGTGAAGA). Horizon Discovery | 7241055 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-05-08) | 7241055 | 2026-09-05 06:52:32 | 0 | |||||
|
LE-Prknem1Sage Resource Report Resource Website |
RRID:RGD_7241058 | Rattus norvegicus | This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 4. Sigma Advanced Genetic Engineering Labs | 7241058 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 7241058 | 2026-09-05 06:52:32 | 0 | |||||
|
LE-Lrrk1em1Sage-/-Lrrk2em1Sage-/- Resource Report Resource Website |
RRID:RGD_7241053 | Rattus norvegicus | ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous Horizon Discovery | 7241053 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 7241053 | 2026-09-05 06:52:32 | 0 | |||||
|
LE-Prknem1Sage-/- Resource Report Resource Website |
RRID:RGD_7241052 | Rattus norvegicus | ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 5-bp frameshift deletion in exon 4 (TCAGT). Horizon Discovery | 7241052 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 7241052 | 2026-09-05 06:52:32 | 0 | |||||
|
LE-Lrrk1em1Sage Resource Report Resource Website |
RRID:RGD_7241051 | Rattus norvegicus | This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4. Horizon Discovery | 7241051 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 7241051 | 2026-09-05 06:52:32 | 0 | |||||
|
W-LeprfaNin Resource Report Resource Website |
RRID:RGD_8655992 | Rattus norvegicus | The spontaneously developed obese rat was derived from the colony of inbred W/Nin by selective breeding. Its lean litter mate ( W-Lepr+/+/Nin, RGD:8655977) was used as a control strain in obesity related study. | 8655992 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 8655992 | 2026-09-05 06:52:32 | 0 | |||||
|
SS-Apoeem9Mcwi Resource Report Resource Website |
RRID:RGD_7364879 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 101-bp deletion in exon 2 and intron 3 | 7364879 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 7364879 | 2026-09-05 06:52:33 | 0 | |||||
|
SD-Rag1em1Ang Resource Report Resource Website |
RRID:RGD_7204136 | Rattus norvegicus | This strain was produced by injecting ZFNs into Sprague-Dawley rat embryos. The resulting mutation is a 5-bp frameshift deletion in the Rag1 gene that predicts a protein with a normal sequence up to aa 245, followed by 5 aa from the insertions and mutations, followed by a stop codon in position 751. | 7204136 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 7204136 | 2026-09-05 06:52:32 | 0 | |||||
|
F344-Sv2am1Kyo Resource Report Resource Website |
RRID:RGD_7800671 | Rattus norvegicus | Established by ENU mutagenesis. A missense mutation (L174Q) mutation in Sv2a: synaptic vesicle glycoprotein 2a, was identified. National BioResource Project for the Rat in Japan | 7800671 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 7800671 | 2026-09-05 06:52:33 | 0 | |||||
|
KFRS2/Kyo-/+ Resource Report Resource Website |
RRID:RGD_7800673 | Rattus norvegicus | A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. National BioResource Project for the Rat in Japan | 7800673 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm | 7800673 | 2026-09-05 06:52:33 | 0 | |||||
|
F344.Cg-Foxn1rnuKyo-/+ Resource Report Resource Website |
RRID:RGD_7800667 | Rattus norvegicus | Jic N13 to Kyo (1988) National BioResource Project for the Rat in Japan | 7800667 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm | 7800667 | 2026-09-05 06:52:34 | 0 | |||||
|
TM-Il2rgem5Kyo Resource Report Resource Website |
RRID:RGD_9685754 | Rattus norvegicus | This strain shows severe combined immunodeficiency caused by a zinc finger nuclease induced 653-bp deletion in Il2rg gene of TM/Kyo embryo. The rats grow normally under SPF condition. National BioResource Project for the Rat in Japan | 9685754 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 9685754 | 2026-09-05 06:52:33 | 0 | |||||
|
TM-Il2rgem4Kyo Resource Report Resource Website |
RRID:RGD_9685752 | Rattus norvegicus | The severe combined immunodeficiency strain carries a zinc finger nuclease-induced 162-bp deletion mutation in rat Il2rg gene. Grows normally under SPF condition. National BioResource Project for the Rat in Japan | 9685752 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 9685752 | 2026-09-05 06:52:33 | 0 | |||||
|
SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi Resource Report Resource Website |
RRID:RGD_10054307 | Rattus norvegicus | The Btg2 mutant rats were generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. Contact MCW rat distribution at [email protected] | 10054307 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2021-11-03) | 10054307 | 2026-09-05 06:52:35 | 0 | |||||
|
LEW-Pkd1em3Mcwi Resource Report Resource Website |
RRID:RGD_10054433 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 12-bp deletion in the Pkd1 gene. Contact MCW rat distribution at [email protected] | 10054433 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054433 | 2026-09-05 06:52:35 | 0 | |||||
|
SD-Drd1em1Ionsz Resource Report Resource Website |
RRID:RGD_11073719 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1. Institute of Neuroscience, Chinese Academy of Sciences | 11073719 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 11073719 | 2026-09-05 06:52:35 | 0 | |||||
|
SD-Abcc6em4Qlju-/- Resource Report Resource Website |
RRID:RGD_10413856 | Rattus norvegicus | This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. | 10413856 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10413856 | 2026-09-05 06:52:35 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.