Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
WKY/NHsdAkr Resource Report Resource Website |
RRID:RGD_13452407 | Rattus norvegicus | These animals were bought from Harlan Indianapolis, Indiana U.S.A. and maintained at the University of Akron breeding colonies, Akron, Ohio. | 13452407 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 13452407 | RGD | 2026-09-26 02:42:08 | 0 | |||||
|
SHR/NHsdAkr Resource Report Resource Website |
RRID:RGD_13452406 | Rattus norvegicus | SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at the University of Akron breeding colonies, Akron, Ohio | 13452406 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 13452406 | RGD | 2026-09-26 02:42:08 | 0 | |||||
|
LH-Chr 17LN/Aek Resource Report Resource Website |
RRID:RGD_12903251 | Rattus norvegicus | Chr 17 from LN was introgressed onto the genetic background of LH by crossing LH/MRrrcAek male to LN/MRrrcAek female rats. | 12903251 | consomic | Rat Genome Database (RGD) | RGD | Unknown | 12903251 | RGD | 2026-09-26 02:42:09 | 0 | |||||
|
SD-Tg(Th-Ghsros) Resource Report Resource Website |
RRID:RGD_12910127 | Rattus norvegicus | This transgenic strain carries a synthetic 108-nucleotide DNA fragment spanning the 5 prime extracellular region of GHS-R was cloned in the antisense orientation driven by tyrosine hydroxylase (Th) promoter. | 12910127 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 12910127 | RGD | 2026-09-26 02:42:09 | 0 | |||||
|
GK/Par Resource Report Resource Website 1+ mentions |
RRID:RGD_13506738 | Rattus norvegicus | The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generation.In 1988, GK/Par substrain was established in Paris, France by initiating breeding pairs F35 from Japanese colonies . | 13506738 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 13506738 | RGD | 2026-09-26 02:42:09 | 1 | |||||
|
NMcwiWfsm:HS Resource Report Resource Website 10+ mentions |
RRID:RGD_13673907 | Rattus norvegicus | These HS rats were derived from NMcwi:HS, used to be maintained by Dr. Solberg Woods at Medical College of Wisconsin and now are maintained at Wake Forest Baptist Medical Center by Dr. Solberg Woods's Laboratory starting in 2017. | 13673907 | outbred | Rat Genome Database (RGD) | RGD | Unknown | 13673907 | RGD | 2026-09-26 02:42:08 | 15 | |||||
|
SHRSP.WKY-(D3Mgh16-D3Rat80)/Gcrc Resource Report Resource Website |
RRID:RGD_13432200 | Rattus norvegicus | Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. | 13432200 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 13432200 | RGD | 2026-09-26 02:42:09 | 0 | |||||
|
SHRSP.WKY-(D3Mgh16-rs65433898)/Gcrc Resource Report Resource Website |
RRID:RGD_13432202 | Rattus norvegicus | Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. | 13432202 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 13432202 | RGD | 2026-09-26 02:42:09 | 0 | |||||
|
SS-Adamts16em1Bj Resource Report Resource Website |
RRID:RGD_13437612 | Rattus norvegicus | This strain was produced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1. | 13437612 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13437612 | RGD | 2026-09-26 02:42:09 | 0 | |||||
|
SHRSP.WKY-(D3Mgh16-D3Mit10)/Gcrc Resource Report Resource Website |
RRID:RGD_13432204 | Rattus norvegicus | Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. | 13432204 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 13432204 | RGD | 2026-09-26 02:42:09 | 0 | |||||
|
SD-Cdkn1bwe Resource Report Resource Website |
RRID:RGD_12910940 | Rattus norvegicus | The multiple endocrine neoplasia (MEN)-like phenotype was initially identified in a Sprague Dawley rat-breeding colony and subsequently maintained by matings between affected and nonaffected littermates. Because cataracts are the first visible sign of the phenotype it was provisionally designated as "Sprague Dawley white eye." The abbreviation SDwe is used to denote animals expressing the mutant phenotype. | 12910940 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12910940 | RGD | 2026-09-26 02:42:09 | 0 | |||||
|
SHRSP.WKY-(D3Wox20-D3Rat114)/Gcrc Resource Report Resource Website |
RRID:RGD_13432199 | Rattus norvegicus | Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. | 13432199 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 13432199 | RGD | 2026-09-26 02:42:09 | 0 | |||||
|
SS.BN-(D13Got45-D13Rat32)/Mcwi Resource Report Resource Website |
RRID:RGD_12792954 | Rattus norvegicus | SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain | 12792954 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 12792954 | RGD | 2026-09-26 02:42:08 | 0 | |||||
|
SD-Tg(Ren2)27-/- Resource Report Resource Website |
RRID:RGD_13513909 | Rattus norvegicus | This is a littermate wild type control strain for SD-Tg(Ren2)27 (RGD:629501), which was generated by the mouse Ren2 renin gene along with its 5' and 3' flanking sequences being microinjected into fertilized eggs from a Hannover Sprague-Dawley (SD) background. | 13513909 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 13513909 | RGD | 2026-09-26 02:42:10 | 0 | |||||
|
SD-Cacna1f csnb Resource Report Resource Website |
RRID:RGD_13782371 | Rattus norvegicus | A naturally-occurring mutation in Cacna1f was identified in a male Sprague Dawley rat with the phenotype of congenital stationary night blindness.Sequence analysis revealed a point mutation of C to T at position 2941, which changes codon 981 from arginine (CGA) to a stop codon (TGA). This R981Stop point mutation was predicted to lead to a version of protein shortened by a total of 999 amino acids, and missing the C-terminal and, in particular, part of the third and all of the fourth ion transport domains. | 13782371 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13782371 | RGD | 2026-09-26 02:42:10 | 0 | |||||
|
SD-Dmdem1Ang Resource Report Resource Website |
RRID:RGD_12880037 | Rattus norvegicus | This mutant strain was generated by injecting TALEN targeting exon23 of rat Dmd into Crl:SD embryo. The resulting mutant is a 11 bp-deletion in exon 23 leading to a +1 grame shift and premature stop codon 81 bp after the mutation. | 12880037 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12880037 | RGD | 2026-09-26 02:42:10 | 0 | |||||
|
WKY-Cyp2j4em1Sage/Tja Resource Report Resource Website 1+ mentions |
RRID:RGD_12904679 | Rattus norvegicus | ZFN system was used to introduce a 25-bp deletion mutation in the exon 4 of Cyp2j4 gene of WKY/NCrl rat embryos. This deletion results in premature stop of protein translation. | 12904679 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12904679 | RGD | 2026-09-26 02:42:09 | 1 | |||||
|
BBDP.BBDR-Gimap5/Sunn Resource Report Resource Website |
RRID:RGD_13702084 | Rattus norvegicus | To generated Gimap5 congenic BBDP/WorSunn rats, the laboratory introgressed the wild-type Gimap5 locus derived from BBDR (BBDR/Wor) rats (Biomedical Research Models) into BBDP/WorSunn rats. Briefly, BBDP/WorSunn and BBDR/Wor rats were crossed, and the resulting F1 animals were backcrossed to BBDP/WorSunn rats. This step was followed by 10 more, marker- assisted backcrosses of Gimap5 heterozygous progeny to BBDP/WorSunn rats. After the eleventh backcross, nonlymphopenic rats were intercrossed, and their progeny homozygous for wild-type Gimap5 were selected for establishing the congenic non-lymphopenic BBDP/WorSunn line (also called BBDP/WorSunn.BBDR-Iddm2). | 13702084 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 13702084 | RGD | 2026-09-26 02:42:09 | 0 | |||||
|
F344-Hsd11b2em1Jmul-/- Resource Report Resource Website |
RRID:RGD_13800556 | Rattus norvegicus | The ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG. | 13800556 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13800556 | RGD | 2026-09-26 02:42:10 | 0 | |||||
|
SD-Mmp12em2Soar Resource Report Resource Website |
RRID:RGD_12910505 | Rattus norvegicus | TALEN mediated 607 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codon | 12910505 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12910505 | RGD | 2026-09-26 02:42:09 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
