Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00005468
Source Database: WormBase (WB)
Affected Genes: WBGene00001079(dpy-20)|WBGene00006766(unc-30)
Genomic Alteration: WBGene00001079(dpy-20), WBGene00006766(unc-30)
Availability: available
Synonyms: dpy-20(e1282) unc-30(e191) IV.
Alternate IDs: WB-STRAIN:DA491, CGC_DA491
Notes: Unc. Temperature sensitive Dpy.
Proper citation: RRID:WB-STRAIN:WBStrain00005468 Copy
http://www.wormbase.org/db/get?name=WBStrain00005501
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006791(unc-57)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006791(unc-57)
Availability: available
Source References: PMID:8462849
Synonyms: unc-57(ad592) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:DA678, CGC_DA678
Notes: DpyUnc. ad592 is Eat. Dpy is semi-dominant.
Proper citation: RRID:WB-STRAIN:WBStrain00005501 Copy
http://www.wormbase.org/db/get?name=WBStrain00005486
Source Database: WormBase (WB)
Affected Genes: WBGene00004921(snt-1)
Genomic Alteration: WBGene00004921(snt-1)
Availability: available
Source References: PMID:8462849
Synonyms: snt-1(ad596) II.
Alternate IDs: WB-STRAIN:DA596, CGC_DA596
Notes: Eat mutant. Strong Unc Eat. Jerky backward Unc. Hypomorph.
Proper citation: RRID:WB-STRAIN:WBStrain00005486 Copy
http://www.wormbase.org/db/get?name=WBStrain00005483
Source Database: WormBase (WB)
Affected Genes: WBGene00001143(eat-14)
Genomic Alteration: WBGene00001143(eat-14)
Availability: available
Source References: PMID:8462849
Synonyms: eat-14(ad573) X.
Alternate IDs: WB-STRAIN:DA573, CGC_DA573
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005483 Copy
http://www.wormbase.org/db/get?name=WBStrain00005484
Source Database: WormBase (WB)
Affected Genes: WBGene00001263(emb-9)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001263(emb-9), WBGene00006768(unc-32)
Availability: available
Synonyms: unc-32(e189) emb-9(hc70) III.
Alternate IDs: WB-STRAIN:DA589, CGC_DA589
Notes: Unc. Temperature sensitive. Maintain at 15C. hc70 is semi-dominant.
Proper citation: RRID:WB-STRAIN:WBStrain00005484 Copy
http://www.wormbase.org/db/get?name=WBStrain00005482
Source Database: WormBase (WB)
Affected Genes: WBGene00001135(eat-4)
Genomic Alteration: WBGene00001135(eat-4)
Availability: available
Source References: PMID:8462849, PMID:31306683
Synonyms: eat-4(ad572) III.
Alternate IDs: WB-STRAIN:DA572, CGC_DA572
Notes: Starved appearance. Reverts spontaneously-Do not passage! Clone starved-looking progeny with abnormal fast pharyngeal pumping to maintain.
Proper citation: RRID:WB-STRAIN:WBStrain00005482 Copy
http://www.wormbase.org/db/get?name=WBStrain00005479
Source Database: WormBase (WB)
Availability: available
Source References: PMID:8462849
Synonyms: adDf538 I.
Alternate IDs: WB-STRAIN:DA538, CGC_DA538
Notes: Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. PKA phm-2(ad538).
Proper citation: RRID:WB-STRAIN:WBStrain00005479 Copy
http://www.wormbase.org/db/get?name=WBStrain00005496
Source Database: WormBase (WB)
Affected Genes: WBGene00001134(eat-3)|WBGene00001867(him-8)
Genomic Alteration: WBGene00001134(eat-3), WBGene00001867(him-8)
Availability: available
Source References: PMID:8462849
Synonyms: eat-3(ad426) II; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:DA631, CGC_DA631
Notes: Abnormal feeding. Slow, irregular feeding. eat-3 exhibits strong maternal effect; dauers seldom recover; Him.|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005496 Copy
http://www.wormbase.org/db/get?name=WBStrain00005494
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)
Genomic Alteration: WBGene00000254(bli-4)
Availability: available
Synonyms: bli-4(e937) adDf538 I.
Alternate IDs: WB-STRAIN:DA612, CGC_DA612
Notes: Blistered. Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. adDf538 previously called phm-2(ad538).
Proper citation: RRID:WB-STRAIN:WBStrain00005494 Copy
http://www.wormbase.org/db/get?name=WBStrain00005495
Source Database: WormBase (WB)
Affected Genes: WBGene00001133(eat-2)|WBGene00002996(lin-7)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001133(eat-2), WBGene00002996(lin-7), WBGene00006787(unc-52)
Availability: available
Synonyms: eat-2(ad465) lin-7(e1413) unc-52(e444) II.
Alternate IDs: WB-STRAIN:DA620, CGC_DA620
Notes: Abnormal feeding: slow, regular pumping. Vulvaless (incomplete penetrance). Unc.
Proper citation: RRID:WB-STRAIN:WBStrain00005495 Copy
http://www.wormbase.org/db/get?name=WBStrain00005493
Source Database: WormBase (WB)
Affected Genes: WBGene00003807(npr-1)
Genomic Alteration: WBGene00003807(npr-1)
Availability: available
Source References: PMID:18993077, PMID:34038721, PMID:37572357, PMID:38446031
Synonyms: npr-1(ad609) X.
Alternate IDs: WB-STRAIN:DA609, CGC_DA609
Notes: Causes worms to aggregate (Bor). Social.|"Supplementary_genotype npr-1(ad609)"|"WBStrain mapped, WBPaper00061439 added based on AFP_Strain data."|"WBStrain provided so WBPaper00061436 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005493 Copy
http://www.wormbase.org/db/get?name=WBStrain00005409
Source Database: WormBase (WB)
Availability: available
Source References: PMID:37432924
Synonyms: juIs198 V.
Alternate IDs: WB-STRAIN:CZ5261, CGC_CZ5261
Notes: juIs198 [unc-25p::YFP::rab-5 + ttx-3p::RFP] V. YFP-labeled RAB-5 synaptic vesicles in GABAergic motor neurons. Reference: Sann SB, Crane MM, Lu H, Jin Y. PLoS One. 2012;7(6):e37930.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00005409 Copy
http://www.wormbase.org/db/get?name=WBStrain00005406
Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CZ4918
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005406 Copy
http://www.wormbase.org/db/get?name=WBStrain00005403
Source Database: WormBase (WB)
Affected Genes: WBGene00004215(ptp-3)
Genomic Alteration: WBGene00004215(ptp-3)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CZ4885
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005403 Copy
http://www.wormbase.org/db/get?name=WBStrain00005489
Source Database: WormBase (WB)
Affected Genes: WBGene00001137(eat-6)
Genomic Alteration: WBGene00001137(eat-6)
Availability: available
Synonyms: eat-6(ad601) V.
Alternate IDs: WB-STRAIN:DA601, CGC_DA601
Notes: Eat. Long pumps; slippery isthmus and corpus.
Proper citation: RRID:WB-STRAIN:WBStrain00005489 Copy
http://www.wormbase.org/db/get?name=WBStrain00005402
Source Database: WormBase (WB)
Affected Genes: WBGene00004215(ptp-3)
Genomic Alteration: WBGene00004215(ptp-3)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CZ4884
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005402 Copy
http://www.wormbase.org/db/get?name=WBStrain00005488
Source Database: WormBase (WB)
Affected Genes: WBGene00001139(eat-8)
Genomic Alteration: WBGene00001139(eat-8)
Availability: available
Source References: PMID:8462849
Synonyms: eat-8(ad599) III.
Alternate IDs: WB-STRAIN:DA599, CGC_DA599
Notes: Abnormal feeding. Brief, rare pumps. Slight coiler Unc.
Proper citation: RRID:WB-STRAIN:WBStrain00005488 Copy
http://www.wormbase.org/db/get?name=WBStrain00005418
Source Database: WormBase (WB)
Affected Genes: WBGene00000042(acr-2)
Genomic Alteration: WBGene00000042(acr-2)
Availability: available
Synonyms: acr-2(n2595 n2420) X.
Alternate IDs: WB-STRAIN:CZ9676, CGC_CZ9676
Notes: Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.|"Made_by: Tammy Stawicki"
Proper citation: RRID:WB-STRAIN:WBStrain00005418 Copy
http://www.wormbase.org/db/get?name=WBStrain00005414
Source Database: WormBase (WB)
Affected Genes: WBGene00003017(lin-31)|WBGene00006868(vab-1)
Genomic Alteration: WBGene00003017(lin-31), WBGene00006868(vab-1)
Availability: available
Synonyms: lin-31(n301) vab-1(e2027) II.
Alternate IDs: WB-STRAIN:CZ7112, CGC_CZ7112
Notes: Muv.
Proper citation: RRID:WB-STRAIN:WBStrain00005414 Copy
http://www.wormbase.org/db/get?name=WBStrain00005415
Source Database: WormBase (WB)
Availability: available
Synonyms: juIs223 IV.
Alternate IDs: WB-STRAIN:CZ8332, CGC_CZ8332
Notes: juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. Transcriptional reporter with ttr-39 promoter driving mCherry expression in DD and VD neurons. Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.
Proper citation: RRID:WB-STRAIN:WBStrain00005415 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
