Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 137 showing 2721 ~ 2740 out of 122,947 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_10413852

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10413852

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10413852
Notes: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.

Proper citation: RRID:RGD_10413852 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10402852

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 10402852
Notes: multiple congenic strain was generated by combining the three separate congenic strains

Proper citation: RRID:RGD_10402852 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12802367

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 12802367
Notes: SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain

Proper citation: RRID:RGD_12802367 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12802366

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 12802366
Notes: SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain

Proper citation: RRID:RGD_12802366 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12802365

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 12802365
Notes: SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain

Proper citation: RRID:RGD_12802365 Copy   


  • RRID:RGD_10450489

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10450489

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10450489
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn Institute of Neuroscience, Chinese Academy of Sciences

Proper citation: RRID:RGD_10450489 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10402850

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 10402850
Notes: double congenic strain was generated by combining the two separate congenic strains

Proper citation: RRID:RGD_10402850 Copy   


  • RRID:RGD_10413858

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10413858

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10413858
Notes: This strain was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.

Proper citation: RRID:RGD_10413858 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12802364

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 12802364
Notes: SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi (RGD:2293145), rats from F1 were intercrossed and genotyped to get the congenic strain

Proper citation: RRID:RGD_12802364 Copy   


  • RRID:RGD_11040527

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040527

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 11040527
Notes: ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_11040527 Copy   


  • RRID:RGD_11040525

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040525

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 11040525
Notes: ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_11040525 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10401835

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 10401835
Notes: A congenic strain made by introducing a 15 Mbp segment of chromosome 17 from F344/NHsd into WKY/Cruk, this region has the distal end of Cm15 QTL

Proper citation: RRID:RGD_10401835 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10401837

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 10401837
Notes: A congenic substrain derived from the progenitor strain WKY.F344-(D17Got91-D17Rat51)/Tja

Proper citation: RRID:RGD_10401837 Copy   


  • RRID:RGD_10395233

    This resource has 50+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10395233

Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 10395233
Notes: Received Sprague-Dawley derived breeding stock from Charles River Laboratory in 1958 and crossed with Sprague-Dawley rats received from ARS/Sprague-Dawley in 1975. Caesarean rederived in 1997. Simonsen Laboratories

Proper citation: RRID:RGD_10395233 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11354901

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 11354901
Notes: This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.

Proper citation: RRID:RGD_11354901 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10401845

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10401845
Notes: ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein.

Proper citation: RRID:RGD_10401845 Copy   


  • RRID:RGD_10395226

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10395226

Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 10395226
Notes: Received from Dr. Evans, University of California, Berkeley - Experimental Institute of Biology in 1949. Caesarean rederived in 1997. Selection is based on the black-hooded phenotype. Simonsen Laboratories

Proper citation: RRID:RGD_10395226 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12792226

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 12792226
Notes: SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain

Proper citation: RRID:RGD_12792226 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10401841

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 10401841
Notes: A congenic substrain derived from the progenitor strain WKY.F344-(D17Got91-D17Rat51)/Tja

Proper citation: RRID:RGD_10401841 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054473

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 10054473
Notes: SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain

Proper citation: RRID:RGD_10054473 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X