Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00005371
Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)|WBGene00006804(unc-71)
Genomic Alteration: WBGene00006762(unc-25), WBGene00006804(unc-71)
Availability: available
Synonyms: juIs76 II; unc-71(ju160) III.
Alternate IDs: WB-STRAIN:CZ1935, CGC_CZ1935
Notes: juIs76 [unc-25p::GFP + lin-15(+)] II. Unc.|"Made_by: X Huang & Y Jin"
Proper citation: RRID:WB-STRAIN:WBStrain00005371 Copy
http://www.wormbase.org/db/get?name=WBStrain00005401
Source Database: WormBase (WB)
Affected Genes: WBGene00006893(spon-1)
Genomic Alteration: WBGene00006893(spon-1)
Availability: available
Synonyms: spon-1(e2623) II.
Alternate IDs: WB-STRAIN:CZ4734, CGC_CZ4734
Notes: Made_by: Wei-Ming Woo|"Maintain under normal conditions. Weak bent head. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56."
Proper citation: RRID:WB-STRAIN:WBStrain00005401 Copy
http://www.wormbase.org/db/get?name=WBStrain00005369
Source Database: WormBase (WB)
Affected Genes: WBGene00006363(syd-1)
Genomic Alteration: WBGene00006363(syd-1)
Availability: available
Synonyms: syd-1(ju82) II.
Alternate IDs: WB-STRAIN:CZ1893, CGC_CZ1893
Notes: Egl. Coiler when moving backwards. Recessive. F35D2.5
Proper citation: RRID:WB-STRAIN:WBStrain00005369 Copy
http://www.wormbase.org/db/get?name=WBStrain00005367
Source Database: WormBase (WB)
Affected Genes: WBGene00003143(max-1)|WBGene00006762(unc-25)
Genomic Alteration: WBGene00003143(max-1), WBGene00006762(unc-25)
Availability: available
Synonyms: juIs76 II; max-1(ju142) V.
Alternate IDs: WB-STRAIN:CZ1758, CGC_CZ1758
Notes: juIs76 [unc-25p::GFP + lin-15(+)] II. Very mild Unc.|"Made_by: X Huang & Y Jin"
Proper citation: RRID:WB-STRAIN:WBStrain00005367 Copy
http://www.wormbase.org/db/get?name=WBStrain00005400
Source Database: WormBase (WB)
Affected Genes: WBGene00006893(spon-1)
Genomic Alteration: WBGene00006893(spon-1)
Availability: available
Synonyms: spon-1(ju430) II.
Alternate IDs: WB-STRAIN:CZ4733, CGC_CZ4733
Notes: Made_by: Wei-Ming Woo|"Temperature-sensitive. Maintain at 15C. Vab. Lethal at 25C. 2-fold Lpy. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56."
Proper citation: RRID:WB-STRAIN:WBStrain00005400 Copy
http://www.wormbase.org/db/get?name=WBStrain00005385
Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CZ3503
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005385 Copy
http://www.wormbase.org/db/get?name=WBStrain00005382
Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CZ3139
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005382 Copy
http://www.wormbase.org/db/get?name=WBStrain00005383
Source Database: WormBase (WB)
Affected Genes: WBGene00006870(vab-3)
Genomic Alteration: WBGene00006870(vab-3)
Availability: available
Synonyms: vab-3(ju468) X.
Alternate IDs: WB-STRAIN:CZ3391, CGC_CZ3391
Notes: Made_by: Nese Cinar|"Mutagen:TMP+UV"|"Mutagen:TMP-UV"|"Vab. Notched Head. Distal tip cell Mig. Male tail ray and spicule defects. Males do not mate. About 50% larval lethality. H and B cell lineage defects. Received new stock Jan. 2006."
Proper citation: RRID:WB-STRAIN:WBStrain00005383 Copy
http://www.wormbase.org/db/get?name=WBStrain00005379
Source Database: WormBase (WB)
Affected Genes: WBGene00006755(unc-16)
Genomic Alteration: WBGene00006755(unc-16)
Availability: available
Synonyms: unc-16(ju146) III.
Alternate IDs: WB-STRAIN:CZ3011, CGC_CZ3011
Notes: Uncoordinated and egg-laying defective. T to C transition resulting in L75P.
Proper citation: RRID:WB-STRAIN:WBStrain00005379 Copy
http://www.wormbase.org/db/get?name=WBStrain00005397
Source Database: WormBase (WB)
Affected Genes: WBGene00001008(dlk-1)
Genomic Alteration: WBGene00001008(dlk-1)
Availability: unknown
Source References: PMID:37722038
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CZ4387
Notes: Supplementary_genotype [DLK-1::GFP + rol-6(su1004)](juIs192) (12)
Proper citation: RRID:WB-STRAIN:WBStrain00005397 Copy
http://www.wormbase.org/db/get?name=WBStrain00005310
Source Database: WormBase (WB)
Availability: available
Source References: PMID:33593818, PMID:33820969, PMID:33983439, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:CX11314, CGC_CX11314
Notes: Made_by: A. Sivasundar|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90."|"WBStrain mapped, WBPaper00061410 added based on AFP_Strain data."|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005310 Copy
http://www.wormbase.org/db/get?name=WBStrain00005396
Source Database: WormBase (WB)
Affected Genes: WBGene00002053(ifb-1)
Genomic Alteration: WBGene00002053(ifb-1)
Availability: available
Synonyms: ifb-1(ju71) II.
Alternate IDs: WB-STRAIN:CZ4380, CGC_CZ4380
Notes: Incompletely penetrant embryonic lethal at three-fold. Mild Mua. Abberant head epidermal morphology. PKA vab-21.|"Made_by: Smelser & Cerna"
Proper citation: RRID:WB-STRAIN:WBStrain00005396 Copy
http://www.wormbase.org/db/get?name=WBStrain00005393
Source Database: WormBase (WB)
Affected Genes: WBGene00006869(vab-2)
Genomic Alteration: WBGene00006869(vab-2)
Availability: available
Synonyms: vab-2(ju1) IV.
Alternate IDs: WB-STRAIN:CZ4111, CGC_CZ4111
Notes: vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal). pka efn-1.
Proper citation: RRID:WB-STRAIN:WBStrain00005393 Copy
http://www.wormbase.org/db/get?name=WBStrain00005392
Source Database: WormBase (WB)
Affected Genes: WBGene00002053(ifb-1)
Genomic Alteration: WBGene00002053(ifb-1)
Availability: available
Synonyms: juEx595.
Alternate IDs: WB-STRAIN:CZ4019, CGC_CZ4019
Notes: juEx595 [IFB-1b::GFP + rol-6(su1006)]. Maintain by picking Rollers. GFP expression patterns are similar to MH4 staining. Maintain by picking rollers.
Proper citation: RRID:WB-STRAIN:WBStrain00005392 Copy
http://www.wormbase.org/db/get?name=WBStrain00005309
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:CX11307, CGC_CX11307
Notes: Made_by: A. Sivasundar|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90."
Proper citation: RRID:WB-STRAIN:WBStrain00005309 Copy
http://www.wormbase.org/db/get?name=WBStrain00005305
Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:CX11285, CGC_CX11285
Notes: Made_by: A. Sivasundar|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90."
Proper citation: RRID:WB-STRAIN:WBStrain00005305 Copy
http://www.wormbase.org/db/get?name=WBStrain00005302
Source Database: WormBase (WB)
Availability: available
Source References: PMID:33593818, PMID:33820969, PMID:37008729, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:CX11271, CGC_CX11271
Notes: Made_by: A. Sivasundar|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90."|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005302 Copy
http://www.wormbase.org/db/get?name=WBStrain00005388
Source Database: WormBase (WB)
Affected Genes: WBGene00001553(gcy-33)
Genomic Alteration: WBGene00001553(gcy-33)
Availability: available
Synonyms: gcy-33(ok232) V.
Alternate IDs: WB-STRAIN:CZ3715, CGC_CZ3715
Notes: 1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00005388 Copy
http://www.wormbase.org/db/get?name=WBStrain00005389
Source Database: WormBase (WB)
Affected Genes: WBGene00004215(ptp-3)
Genomic Alteration: WBGene00004215(ptp-3)
Availability: available
Source References: PMID:33147118
Synonyms: ptp-3(mu256) II.
Alternate IDs: WB-STRAIN:CZ3761, CGC_CZ3761
Notes: Low penetrance tail Vab and embryonic lethality.|"WBStrain mapped, WBPaper00060580 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005389 Copy
http://www.wormbase.org/db/get?name=WBStrain00005321
Source Database: WormBase (WB)
Availability: available
Synonyms: ggr-2(lf62) X.
Alternate IDs: WB-STRAIN:CX12708, CGC_CX12708
Notes: Made_by: Steven Flavell|"Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35."
Proper citation: RRID:WB-STRAIN:WBStrain00005321 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
