Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Availability:unknown (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

122,947 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Authority Record Last Update Mentions Count
ACI.BN-(D7Rat206-D7Uwm30)/Shul
 
Resource Report
Resource Website
RRID:RGD_7248729 Rattus norvegicus This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7248729 congenic Rat Genome Database (RGD) RGD Unknown 7248729 RGD 2026-09-26 02:42:05 0
SS.LEW-(D5Mco39-D5Mco41)(D5Mco42-D5Mco47)/Mco
 
Resource Report
Resource Website
RRID:RGD_7794706 Rattus norvegicus male and female pairs of the monocongenic SS.LEW-(D5Mco39-D5Mco41)/Mco and SS.LEW-(D5Mco42-D5Mco47)/2Mco were randomly selected and intercrossed to get F1; the heterozygous animals for the desired region were intercrossed to get the bicongenics 7794706 congenic Rat Genome Database (RGD) RGD Unknown 7794706 RGD 2026-09-26 02:42:05 0
SS.LEW-(D5Mco42-D5Mco47)/2Mco
 
Resource Report
Resource Website
RRID:RGD_7794704 Rattus norvegicus SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain 7794704 congenic Rat Genome Database (RGD) RGD Unknown 7794704 RGD 2026-09-26 02:42:05 0
SS.MNS-(D2Chm33-Tm2sf1),LEW-(D3Rat2-D3Chm79)/Ayd
 
Resource Report
Resource Website
RRID:RGD_8551778 Rattus norvegicus A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm33-Tm2sf1)/Ayd and SS.LEW-(D3Rat2-D3Chm79)/Ayd 8551778 congenic Rat Genome Database (RGD) RGD Unknown 8551778 RGD 2026-09-26 02:42:05 0
WF.WKY-(D5Uwm78-D5Uwm98)/Uwm
 
Resource Report
Resource Website
RRID:RGD_6907076 Rattus norvegicus A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907076 congenic Rat Genome Database (RGD) RGD Unknown 6907076 RGD 2026-09-26 02:42:05 0
WF.WKY-(D5Uwm95-D5Uwm98)/Uwm
 
Resource Report
Resource Website
RRID:RGD_6907078 Rattus norvegicus A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907078 congenic Rat Genome Database (RGD) RGD Unknown 6907078 RGD 2026-09-26 02:42:05 0
SHR/NCrlPrin
 
Resource Report
Resource Website
RRID:RGD_9586448 Rattus norvegicus Substrain of SHR originally from Charles River now maintained at University of California 9586448 inbred Rat Genome Database (RGD) RGD Unknown 9586448 RGD 2026-09-26 02:42:05 0
SS.SHR-(D9Mco115-D9Mco124)/Bj
 
Resource Report
Resource Website
RRID:RGD_11354930 Rattus norvegicus This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. 11354930 congenic Rat Genome Database (RGD) RGD Unknown 11354930 RGD 2026-09-26 02:42:06 0
SD-Drd1em1Ionsz
 
Resource Report
Resource Website
RRID:RGD_11073719 Rattus norvegicus CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1. Institute of Neuroscience, Chinese Academy of Sciences 11073719 mutant Rat Genome Database (RGD) RGD Unknown 11073719 RGD 2026-09-26 02:42:06 0
SD-Abcc6em4Qlju-/-
 
Resource Report
Resource Website
RRID:RGD_10413856 Rattus norvegicus This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. 10413856 mutant Rat Genome Database (RGD) RGD Unknown 10413856 RGD 2026-09-26 02:42:06 0
SD-Gfapem1(2A-Chr2-EYFP)Ionsz
 
Resource Report
Resource Website
1+ mentions
RRID:RGD_10054279 Rattus norvegicus CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A ( the self-cleaving 2A peptide sequence from foot-and-mouth disease virus or other picornaviruses), blue light-gated cation channel channelrhodopsin-2 (ChR2) and EYFP behind the last exon of Gfap. Institute of Neuroscience, Chinese Academy of Sciences 10054279 mutant Rat Genome Database (RGD) RGD Unknown 10054279 RGD 2026-09-26 02:42:06 2
SD-Vcpem1Ionsz
 
Resource Report
Resource Website
RRID:RGD_10054276 Rattus norvegicus CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat that made the 155th amino acid Arg into His 10054276 mutant Rat Genome Database (RGD) RGD Unknown 10054276 RGD 2026-09-26 02:42:06 0
SS.LEW-(D17Chm131-D17Chm93)(D10Chm10-D10Rat11)/Ayd
 
Resource Report
Resource Website
RRID:RGD_8551732 Rattus norvegicus A double congenic strain derived from the progenitor strain SS.LEW-(D17Chm31-D17Chm93)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd 8551732 congenic Rat Genome Database (RGD) RGD Unknown 8551732 RGD 2026-09-26 02:42:05 0
SS.LEW-(D3Rat2-D3Chm79)(D10Chm10-D10Rat11)/Ayd
 
Resource Report
Resource Website
RRID:RGD_8551730 Rattus norvegicus A double congenic strain derived from the progenitor strain SS.LEW-(D3Rat2-D3Chm79)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd 8551730 congenic Rat Genome Database (RGD) RGD Unknown 8551730 RGD 2026-09-26 02:42:05 0
SD-Lepem1Narl
 
Resource Report
Resource Website
RRID:RGD_10401851 Rattus norvegicus CRISPR/Cas9 system was used to generate this mutant. This mutant strain has increased body weight, increased circulating cholesterol level and increased triglyceride level compared to its littermates 10401851 mutant Rat Genome Database (RGD) RGD Unknown 10401851 RGD 2026-09-26 02:42:06 0
SS.LEW-(D17Chm131-D17Chm93)(D17Rat84-D17Chm17)/Ayd
 
Resource Report
Resource Website
RRID:RGD_8551734 Rattus norvegicus A double congenic strain derived from the progenitor strain SS.LEW-(D17Chm31-D17Chm93)/Ayd and SS.LEW-(D17Rat84-D17Chm17)/Ayd 8551734 congenic Rat Genome Database (RGD) RGD Unknown 8551734 RGD 2026-09-26 02:42:05 0
SS.LEW-(D10Chm280-D10Chm216)/Ayd
 
Resource Report
Resource Website
RRID:RGD_8657135 Rattus norvegicus A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd 8657135 congenic Rat Genome Database (RGD) RGD Unknown 8657135 RGD 2026-09-26 02:42:05 0
SS.LEW-(D16Chm48-D16Chm60)(D18Rat101-D18Rat92)/Ayd
 
Resource Report
Resource Website
RRID:RGD_8551742 Rattus norvegicus A double congenic strain derived from the progenitor strain SS.LEW-(D16Chm48-D16Chm60)/Ayd and SS.LEW-(D18Rat101-D18Rat92)/Ayd 8551742 congenic Rat Genome Database (RGD) RGD Unknown 8551742 RGD 2026-09-26 02:42:05 0
SS.SHR-(D9Mco110-D9Mco114)/Bj
 
Resource Report
Resource Website
RRID:RGD_11354928 Rattus norvegicus This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. 11354928 congenic Rat Genome Database (RGD) RGD Unknown 11354928 RGD 2026-09-26 02:42:06 0
SS.SHR-(D9Mco110-D9Got111)/Bj
 
Resource Report
Resource Website
RRID:RGD_11354926 Rattus norvegicus This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. 11354926 congenic Rat Genome Database (RGD) RGD Unknown 11354926 RGD 2026-09-26 02:42:06 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.