Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
ACI.BN-(D7Rat206-D7Uwm30)/Shul Resource Report Resource Website |
RRID:RGD_7248729 | Rattus norvegicus | This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. | 7248729 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 7248729 | RGD | 2026-09-26 02:42:05 | 0 | |||||
|
SS.LEW-(D5Mco39-D5Mco41)(D5Mco42-D5Mco47)/Mco Resource Report Resource Website |
RRID:RGD_7794706 | Rattus norvegicus | male and female pairs of the monocongenic SS.LEW-(D5Mco39-D5Mco41)/Mco and SS.LEW-(D5Mco42-D5Mco47)/2Mco were randomly selected and intercrossed to get F1; the heterozygous animals for the desired region were intercrossed to get the bicongenics | 7794706 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 7794706 | RGD | 2026-09-26 02:42:05 | 0 | |||||
|
SS.LEW-(D5Mco42-D5Mco47)/2Mco Resource Report Resource Website |
RRID:RGD_7794704 | Rattus norvegicus | SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain | 7794704 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 7794704 | RGD | 2026-09-26 02:42:05 | 0 | |||||
|
SS.MNS-(D2Chm33-Tm2sf1),LEW-(D3Rat2-D3Chm79)/Ayd Resource Report Resource Website |
RRID:RGD_8551778 | Rattus norvegicus | A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm33-Tm2sf1)/Ayd and SS.LEW-(D3Rat2-D3Chm79)/Ayd | 8551778 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 8551778 | RGD | 2026-09-26 02:42:05 | 0 | |||||
|
WF.WKY-(D5Uwm78-D5Uwm98)/Uwm Resource Report Resource Website |
RRID:RGD_6907076 | Rattus norvegicus | A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. | 6907076 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 6907076 | RGD | 2026-09-26 02:42:05 | 0 | |||||
|
WF.WKY-(D5Uwm95-D5Uwm98)/Uwm Resource Report Resource Website |
RRID:RGD_6907078 | Rattus norvegicus | A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. | 6907078 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 6907078 | RGD | 2026-09-26 02:42:05 | 0 | |||||
|
SHR/NCrlPrin Resource Report Resource Website |
RRID:RGD_9586448 | Rattus norvegicus | Substrain of SHR originally from Charles River now maintained at University of California | 9586448 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 9586448 | RGD | 2026-09-26 02:42:05 | 0 | |||||
|
SS.SHR-(D9Mco115-D9Mco124)/Bj Resource Report Resource Website |
RRID:RGD_11354930 | Rattus norvegicus | This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. | 11354930 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 11354930 | RGD | 2026-09-26 02:42:06 | 0 | |||||
|
SD-Drd1em1Ionsz Resource Report Resource Website |
RRID:RGD_11073719 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1. Institute of Neuroscience, Chinese Academy of Sciences | 11073719 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 11073719 | RGD | 2026-09-26 02:42:06 | 0 | |||||
|
SD-Abcc6em4Qlju-/- Resource Report Resource Website |
RRID:RGD_10413856 | Rattus norvegicus | This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. | 10413856 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10413856 | RGD | 2026-09-26 02:42:06 | 0 | |||||
|
SD-Gfapem1(2A-Chr2-EYFP)Ionsz Resource Report Resource Website 1+ mentions |
RRID:RGD_10054279 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A ( the self-cleaving 2A peptide sequence from foot-and-mouth disease virus or other picornaviruses), blue light-gated cation channel channelrhodopsin-2 (ChR2) and EYFP behind the last exon of Gfap. Institute of Neuroscience, Chinese Academy of Sciences | 10054279 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10054279 | RGD | 2026-09-26 02:42:06 | 2 | |||||
|
SD-Vcpem1Ionsz Resource Report Resource Website |
RRID:RGD_10054276 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat that made the 155th amino acid Arg into His | 10054276 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10054276 | RGD | 2026-09-26 02:42:06 | 0 | |||||
|
SS.LEW-(D17Chm131-D17Chm93)(D10Chm10-D10Rat11)/Ayd Resource Report Resource Website |
RRID:RGD_8551732 | Rattus norvegicus | A double congenic strain derived from the progenitor strain SS.LEW-(D17Chm31-D17Chm93)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd | 8551732 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 8551732 | RGD | 2026-09-26 02:42:05 | 0 | |||||
|
SS.LEW-(D3Rat2-D3Chm79)(D10Chm10-D10Rat11)/Ayd Resource Report Resource Website |
RRID:RGD_8551730 | Rattus norvegicus | A double congenic strain derived from the progenitor strain SS.LEW-(D3Rat2-D3Chm79)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd | 8551730 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 8551730 | RGD | 2026-09-26 02:42:05 | 0 | |||||
|
SD-Lepem1Narl Resource Report Resource Website |
RRID:RGD_10401851 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant. This mutant strain has increased body weight, increased circulating cholesterol level and increased triglyceride level compared to its littermates | 10401851 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10401851 | RGD | 2026-09-26 02:42:06 | 0 | |||||
|
SS.LEW-(D17Chm131-D17Chm93)(D17Rat84-D17Chm17)/Ayd Resource Report Resource Website |
RRID:RGD_8551734 | Rattus norvegicus | A double congenic strain derived from the progenitor strain SS.LEW-(D17Chm31-D17Chm93)/Ayd and SS.LEW-(D17Rat84-D17Chm17)/Ayd | 8551734 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 8551734 | RGD | 2026-09-26 02:42:05 | 0 | |||||
|
SS.LEW-(D10Chm280-D10Chm216)/Ayd Resource Report Resource Website |
RRID:RGD_8657135 | Rattus norvegicus | A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd | 8657135 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 8657135 | RGD | 2026-09-26 02:42:05 | 0 | |||||
|
SS.LEW-(D16Chm48-D16Chm60)(D18Rat101-D18Rat92)/Ayd Resource Report Resource Website |
RRID:RGD_8551742 | Rattus norvegicus | A double congenic strain derived from the progenitor strain SS.LEW-(D16Chm48-D16Chm60)/Ayd and SS.LEW-(D18Rat101-D18Rat92)/Ayd | 8551742 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 8551742 | RGD | 2026-09-26 02:42:05 | 0 | |||||
|
SS.SHR-(D9Mco110-D9Mco114)/Bj Resource Report Resource Website |
RRID:RGD_11354928 | Rattus norvegicus | This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. | 11354928 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 11354928 | RGD | 2026-09-26 02:42:06 | 0 | |||||
|
SS.SHR-(D9Mco110-D9Got111)/Bj Resource Report Resource Website |
RRID:RGD_11354926 | Rattus norvegicus | This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. | 11354926 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 11354926 | RGD | 2026-09-26 02:42:06 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
