Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00006649
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3077, CGC_ED3077
Notes: Caenorhabditis elegans wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta.|"Made_by: E. Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006649 Copy
http://www.wormbase.org/db/get?name=WBStrain00006646
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3073, CGC_ED3073
Notes: Made_by: E. Dolgin|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90."
Proper citation: RRID:WB-STRAIN:WBStrain00006646 Copy
http://www.wormbase.org/db/get?name=WBStrain00006645
Source Database: WormBase (WB)
Availability: available
Source References: PMID:37572357
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3072, CGC_ED3072
Notes: Caenorhabditis elegans wild isolate. Isolated from compost from the Olive Mushroom Farms near the town of Limuru, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon.|"Made_by: E. Dolgin"|"Supplementary_genotype"
Proper citation: RRID:WB-STRAIN:WBStrain00006645 Copy
http://www.wormbase.org/db/get?name=WBStrain00006644
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3071, CGC_ED3071
Notes: Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon."|"Made_by: A Cutter & E Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006644 Copy
http://www.wormbase.org/db/get?name=WBStrain00006643
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:ED3057
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00006643 Copy
http://www.wormbase.org/db/get?name=WBStrain00006663
Source Database: WormBase (WB)
Affected Genes: WBGene00018854(nlf-1)
Genomic Alteration: WBGene00018854(nlf-1)
Availability: unknown
Source References: PMID:28325749
Synonyms: nlf-1(ox327) X.
Alternate IDs: WB-STRAIN:EG327
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00006663 Copy
http://www.wormbase.org/db/get?name=WBStrain00006661
Source Database: WormBase (WB)
Affected Genes: WBGene00001373(exp-1)
Genomic Alteration: WBGene00001373(exp-1)
Availability: available
Source References: EMPTY
Synonyms: exp-1(ox276) II.
Alternate IDs: WB-STRAIN:EG276, CGC_EG276
Notes: Maintain under normal conditions. Reference: Beg AA & Jorgensen EM, Nat Neurosci. 2003 Nov;6(11):1145-52.
Proper citation: RRID:WB-STRAIN:WBStrain00006661 Copy
http://www.wormbase.org/db/get?name=WBStrain00006660
Source Database: WormBase (WB)
Affected Genes: WBGene00003553(nas-37)
Genomic Alteration: WBGene00003553(nas-37)
Availability: available
Source References: PMID:38177158
Synonyms: nas-37(ox199) X.
Alternate IDs: WB-STRAIN:EG199, CGC_EG199
Notes: At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.
Proper citation: RRID:WB-STRAIN:WBStrain00006660 Copy
http://www.wormbase.org/db/get?name=WBStrain00006659
Source Database: WormBase (WB)
Affected Genes: WBGene00002138(inx-16)
Genomic Alteration: WBGene00002138(inx-16)
Availability: available
Source References: EMPTY
Synonyms: inx-16(ox144) I.
Alternate IDs: WB-STRAIN:EG144, CGC_EG144
Notes: Pax, Dec-slow (34 defecation cycle). Maintain uder normal conditions. Reference: Peters MA, et al. Curr Biol. 2007 Sep 18;17(18):1601-8.
Proper citation: RRID:WB-STRAIN:WBStrain00006659 Copy
http://www.wormbase.org/db/get?name=WBStrain00006658
Source Database: WormBase (WB)
Affected Genes: WBGene00003943(pbo-4)
Genomic Alteration: WBGene00003943(pbo-4)
Availability: unknown
Source References: EMPTY
Synonyms: pbo-4(ox10)X.
Alternate IDs: WB-STRAIN:EG10
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00006658 Copy
http://www.wormbase.org/db/get?name=WBStrain00006657
Source Database: WormBase (WB)
Affected Genes: WBGene00012857(pbo-5)
Genomic Alteration: WBGene00012857(pbo-5)
Availability: available
Source References: EMPTY
Synonyms: pbo-5(ox4) V.
Alternate IDs: WB-STRAIN:EG4, CGC_EG4
Notes: Abnormal posterior body muscle contractions during defecation. Derived by single outcrossing of MT1733; allelic to n2303.|"Made_by: Paola DaSanta"
Proper citation: RRID:WB-STRAIN:WBStrain00006657 Copy
http://www.wormbase.org/db/get?name=WBStrain00006674
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: lin-15B&lin-15A(n765) X; oxEx110.
Alternate IDs: WB-STRAIN:EG2288, CGC_EG2288
Notes: oxEx110 [unc-49c::GFP + lin-15(+)]. Maintain by picking non-Muv.
Proper citation: RRID:WB-STRAIN:WBStrain00006674 Copy
http://www.wormbase.org/db/get?name=WBStrain00006673
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:EG1862
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00006673 Copy
http://www.wormbase.org/db/get?name=WBStrain00006672
Source Database: WormBase (WB)
Affected Genes: WBGene00006784(unc-49)
Genomic Alteration: WBGene00006784(unc-49)
Availability: available
Source References: EMPTY
Synonyms: oxIs22 II.
Alternate IDs: WB-STRAIN:EG1653, CGC_EG1653
Notes: Made_by: Bamber/Bessereau|"Mutagen: Psoralen"|"Mutagen:Integrated using Psoralen."|"oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Psoralen integration of oxEx129 [unc-49Bp(long)::GFP + lin-15(+)]. Dorsal and ventral."
Proper citation: RRID:WB-STRAIN:WBStrain00006672 Copy
http://www.wormbase.org/db/get?name=WBStrain00006671
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: lin-15B&lin-15A(n765) X; oxEx166.
Alternate IDs: WB-STRAIN:EG1642, CGC_EG1642
Notes: oxEx166 [HSP::MosTRANSPOSASE + CC::GFP + lin-15(+)]. Should be grown at 25C. Maintain by picking non-Muv. Animals carrying the array should be GFP+.
Proper citation: RRID:WB-STRAIN:WBStrain00006671 Copy
http://www.wormbase.org/db/get?name=WBStrain00006669
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)
Genomic Alteration: WBGene00003514(myo-2)
Availability: available
Source References: EMPTY
Synonyms: oxEx229.
Alternate IDs: WB-STRAIN:EG1470, CGC_EG1470
Notes: oxEx229 [Mos1 Substrate + myo-2::GFP]. Should be grown at 25C.
Proper citation: RRID:WB-STRAIN:WBStrain00006669 Copy
http://www.wormbase.org/db/get?name=WBStrain00006668
Source Database: WormBase (WB)
Affected Genes: WBGene00006783(unc-47)
Genomic Alteration: WBGene00006783(unc-47)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:EG1306
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00006668 Copy
http://www.wormbase.org/db/get?name=WBStrain00006701
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:37587694
Synonyms: oxIs318 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:EG4883, CGC_EG4883
Notes: Mutagen:Mos1 transposase|"oxIs318 [spe-11p::mCherry::histone + unc-119(+)]. Wild type. Dim mCherry expression in hermaphrodite sperm. Barely visible on bright dissection microscope; visible on compound microscope. Plasmid pCFJ167 inserted by MosSCI into ttTi5605 site."
Proper citation: RRID:WB-STRAIN:WBStrain00006701 Copy
http://www.wormbase.org/db/get?name=WBStrain00006667
Source Database: WormBase (WB)
Affected Genes: WBGene00006783(unc-47)|WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00006783(unc-47), WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: PMID:31662251, PMID:34387338, PMID:37083456, PMID:37756590, PMID:37910615, PMID:39097626, PMID:39615303
Synonyms: lin-15B&lin-15A(n765) oxIs12 X.
Alternate IDs: WB-STRAIN:EG1285, CGC_EG1285
Notes: Mutagen:Integrated by X-rays|"oxIs12 [unc-47p::GFP + lin-15(+)]. Integration maps at +2.0 on X. Expression of GFP in all GABAergic neurons."|"Supplementary_genotype GABA-GFP oxIs12 [unc-47p::GFP + lin-15(+)]"|"Supplementary_genotype oxIs12 [unc-47p::GFP + lin-15(+)]"|"Supplementary_genotype oxIs12[punc-47::gfp] X"|"WBStrain provided so WBPaper00061788 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00006667 Copy
http://www.wormbase.org/db/get?name=WBStrain00006666
Source Database: WormBase (WB)
Affected Genes: WBGene00000256(bli-6)|WBGene00001073(dpy-11)|WBGene00003056(lon-2)
Genomic Alteration: WBGene00000256(bli-6), WBGene00001073(dpy-11), WBGene00003056(lon-2)
Availability: available
Source References: PMID:37310364
Synonyms: bli-6(sc16) IV; dpy-11(e224) V; lon-2(e678) X.
Alternate IDs: WB-STRAIN:EG1020, CGC_EG1020
Notes: Dpy suppresses Bli and Lon. Strain appears to be only slightly Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-11 causes dumpiness, bli-6 adult worms develop blisters on their bodies, and lon-2 worms are about 150% WT length.|"WBStrain provided so WBPaper00060449 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00006666 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
