Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00062213
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: juSi164 unc-119(ed3) III; wtfIs335.
Notes: juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs335 [5xQUAS+(delta)pes-10p::AI::eTsChR::unc-54 3'UTR + rab-3p::AI::QF+hGR::SL2::tagBFP::unc-54 3'UTR + rab-3p::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal eTsChR on activation using dex treatment via QF+hGR. Worms also express calcium sensing fluorescence protein- GCaMP6s in nuclei of each neurons. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
Proper citation: RRID:WB-STRAIN:WBStrain00062213 Copy
http://www.wormbase.org/db/get?name=WBStrain00062211
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: juSi164 unc-119(ed3) III; wtfEx296.
Notes: juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx296 [rab-3p::AI::gur-3G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Pick RFP+ to maintain. Keep plates covered to avoid unnecessary exposure to light. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
Proper citation: RRID:WB-STRAIN:WBStrain00062211 Copy
http://www.wormbase.org/db/get?name=WBStrain00062249
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: unc-119(kst33) III.
Notes: Made_by: Mohammed Aljohani|"Maintain at 15C. Temperature-sensitive unc-119 allele. Wild-type at 15C, intermediate Unc and Egl at 20C, and fully penetrant Unc and Egl at 25C. For use in transgenesis, maintain the strain at lower temperatures for increased brood size and easier injection, then transfer animals to 25C to select for transgenic animals based on Unc rescue. Molecular characterization shows a complex allele with a 210 bp duplication from a nearby exon-intron junction, which introduces 12 amino acids and a putative splice donor at a consensus splice acceptor site. The phenotype is most likely caused by temperature-sensitive splicing defects based on RT-PCR. Reference: Aljohani M, et al. Arrayed oligo libraries: genome-wide DNA- and RNP-based platforms for templated and non-templated CRISPR-Cas9 editing in C. elegans. (Submitted)"
Proper citation: RRID:WB-STRAIN:WBStrain00062249 Copy
http://www.wormbase.org/db/get?name=WBStrain00062599
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00020142(aak-2)
Genomic Alteration: WBGene00006843(unc-119), WBGene00020142(aak-2)
Availability: unknown
Synonyms: unc-119(ed3) III; aak-2(ok524) X; fphEx3.
Notes: fphEx3 [aak-2Ap::aak-2C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2c isoform expressed from the aak-2a promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.
Proper citation: RRID:WB-STRAIN:WBStrain00062599 Copy
http://www.wormbase.org/db/get?name=WBStrain00062596
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00020142(aak-2)
Genomic Alteration: WBGene00006843(unc-119), WBGene00020142(aak-2)
Availability: unknown
Synonyms: unc-119(ed3) III; aak-2(ok524) X; fphIs1.
Notes: fphIs1 [aak-2Ap::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed with its own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.
Proper citation: RRID:WB-STRAIN:WBStrain00062596 Copy
http://www.wormbase.org/db/get?name=WBStrain00062597
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00020142(aak-2)
Genomic Alteration: WBGene00006843(unc-119), WBGene00020142(aak-2)
Availability: unknown
Synonyms: unc-119(ed3) III; aak-2(ok524) X; fphEx1.
Notes: fphEx1 [aak-2Cp::aak-2C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2C isoform expressed from its own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.
Proper citation: RRID:WB-STRAIN:WBStrain00062597 Copy
http://www.wormbase.org/db/get?name=WBStrain00062601
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00020142(aak-2)
Genomic Alteration: WBGene00006843(unc-119), WBGene00020142(aak-2)
Availability: unknown
Synonyms: unc-119(ed3) III; aak-2(ok524) X; fphIs3.
Notes: fphIs3 [rab-3p::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed from the neuronal rab-3 promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.
Proper citation: RRID:WB-STRAIN:WBStrain00062601 Copy
http://www.wormbase.org/db/get?name=WBStrain00062706
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: rajSi50 II; unc-119(ed3) III.
Notes: Made_by: Kathrin Theil|"rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
Proper citation: RRID:WB-STRAIN:WBStrain00062706 Copy
http://www.wormbase.org/db/get?name=WBStrain00062767
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: mirSi29 II; unc-119(ed3) III.
Notes: Made_by: Neus Sanfeliu Cerdan|"mirSi29 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ACR1 and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651."
Proper citation: RRID:WB-STRAIN:WBStrain00062767 Copy
http://www.wormbase.org/db/get?name=WBStrain00062768
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: mirSi34 II; unc-119(ed3) III.
Notes: Made_by: Neus Sanfeliu Cerdan|"mirSi34 [myo-3p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in body wall muscles. Combine with CRE driven by a promoter expressed in desired muscle cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651."
Proper citation: RRID:WB-STRAIN:WBStrain00062768 Copy
http://www.wormbase.org/db/get?name=WBStrain00062758
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: mirSi16 II; unc-119(ed3) III; mirIs110 V; mirIs107.
Notes: mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs110 [odr-7p::TeNL + unc-122p::GFP *oxTi553 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] V. mirIs107 [gpa:14p::CRE + npr-9p::ChR-HRDC::YFP::SL2::jRGECO1a + rps-0p::hygroR]. Blue fluorescence in flp-18 expressing neurons. Green coelomycetes segregates with calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in AWA. ChR2-HRDC and jRGECO1a in AVA (instead of BFP) and ChR2-HRDC::YFP and jRGECO1a in AIB. HygroR. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
Proper citation: RRID:WB-STRAIN:WBStrain00062758 Copy
http://www.wormbase.org/db/get?name=WBStrain00062759
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: mirSi16 II; unc-119(ed3) III.
Notes: mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
Proper citation: RRID:WB-STRAIN:WBStrain00062759 Copy
http://www.wormbase.org/db/get?name=WBStrain00062750
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: unc-119(ed3) III; qbcSi12 IV.
Notes: qbcSi112 [elt-2p::GFP::his-58::3XmiR-228(mut)::tbb-2 3UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
Proper citation: RRID:WB-STRAIN:WBStrain00062750 Copy
http://www.wormbase.org/db/get?name=WBStrain00062751
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: unc-119(ed3) III; qbcSi11 IV.
Notes: qbcSi11 [elt-1p::GFP::his-58::3XmiR-228::tbb-2 3UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
Proper citation: RRID:WB-STRAIN:WBStrain00062751 Copy
http://www.wormbase.org/db/get?name=WBStrain00062749
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: unc-119(ed3) III; qbcSi10 IV.
Notes: qbcSi10 [mex-5p::GFP::his-58::3XmiR-228(mut)::tbb-2 3UTR + unc-119(+)] IV. Germline-specific miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
Proper citation: RRID:WB-STRAIN:WBStrain00062749 Copy
http://www.wormbase.org/db/get?name=WBStrain00035144
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:26024448
Synonyms: unc-119(ed3) ruIs32 III; ojIs1.
Alternate IDs: WB-STRAIN:TY3558, CGC_TY3558
Notes: ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Histone and tubulin GFP.
Proper citation: RRID:WB-STRAIN:WBStrain00035144 Copy
http://www.wormbase.org/db/get?name=WBStrain00035229
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: oaSi20 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:UE75, CGC_UE75
Notes: oaSi20 [par-5p::GFP::par-5::par-5 3' UTR(mutated splice sites, mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.1 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
Proper citation: RRID:WB-STRAIN:WBStrain00035229 Copy
http://www.wormbase.org/db/get?name=WBStrain00035228
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: oaSi17 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:UE72, CGC_UE72
Notes: oaSi17 [par-5p::GFP::par-5::par-5 3' UTR(mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the long PAR-5 3'UTR isoforms (utr.1 and utr.2). Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
Proper citation: RRID:WB-STRAIN:WBStrain00035228 Copy
http://www.wormbase.org/db/get?name=WBStrain00035221
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: oaSi10 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:UE50, CGC_UE50
Notes: oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
Proper citation: RRID:WB-STRAIN:WBStrain00035221 Copy
http://www.wormbase.org/db/get?name=WBStrain00035223
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: oaSi11 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:UE52, CGC_UE52
Notes: oaSi11 [par-5p::par-5::par-5 3' UTR.2(prespliced) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
Proper citation: RRID:WB-STRAIN:WBStrain00035223 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.