Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037194
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00018152(acs-4)
Genomic Alteration: WBGene00000254(bli-4), WBGene00018152(acs-4)
Availability: available
Source References: PMID:37164154
Synonyms: acs-4(ok2872) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2240, CGC_VC2240
Notes: F37C12.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2872 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTTTCAGGCAAATTGGGT. External right primer: TTCCTGTGCTCAAGTCGTTG. Internal left primer: ATGTTTGGGAACTCGACAGC. Internal right primer: ATCCTTGAACAACAGGGCAG. Internal WT amplicon: 1170 bp. Deletion size: 335 bp. Deletion left flank: CTGAAGACCCTGATTTATTTCGCTCCTGTG. Deletion right flank: AATTTTTATTGGATTTAAAACTCATTTTAC. Insertion Sequence: CGAAATA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037194 Copy
http://www.wormbase.org/db/get?name=WBStrain00037192
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00015021(nfs-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00015021(nfs-1)
Availability: available
Source References: EMPTY
Synonyms: B0205.6(ok2890) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2238, CGC_VC2238
Notes: B0205.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2890 homozygotes (sterile unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGAACAAAACCAGCAAT. External right primer: CCTGTCCTCCACCAGACATT. Internal left primer: CTCGAGTAGTCGACGCAATG. Internal right primer: GCTTCAATACGAACACGTGGA. Internal WT amplicon: 1094 bp. Deletion size: 255 bp. Deletion left flank: ACTGAATCAAATAATTTGGCGATTAAAGGA. Deletion right flank: ATATTTGGAAAATGAAGGATTTAAAGTGAC. Insertion Sequence: TTTTGGAAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037192 Copy
http://www.wormbase.org/db/get?name=WBStrain00037110
Source Database: WormBase (WB)
Affected Genes: WBGene00010049(F54D5.3)
Genomic Alteration: WBGene00010049(F54D5.3)
Availability: available
Source References: EMPTY
Synonyms: F54D5.3(ok2891) II.
Alternate IDs: WB-STRAIN:VC2143, CGC_VC2143
Notes: F54D5.3. External left primer: TTGGCTTTGCAGGAGCTAAT. External right primer: CAAAATGCAGCGAAAAACAA. Internal left primer: CACCGATGACACTGGTCACT. Internal right primer: CAATTTGGCCGGAGATTTTA. Internal WT amplicon: 1165 bp. Deletion size: 455 bp. Deletion left flank: CTATTTAATAAGCTTCGTTACCAACTTCTG. Deletion right flank: CAAGGTTCGAATTGGATTTTTTTTAACTAA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037110 Copy
http://www.wormbase.org/db/get?name=WBStrain00037197
Source Database: WormBase (WB)
Affected Genes: WBGene00010323(dhhc-12)
Genomic Alteration: WBGene00010323(dhhc-12)
Availability: available
Source References: EMPTY
Synonyms: F59C6.2(gk981) I.
Alternate IDs: WB-STRAIN:VC2244, CGC_VC2244
Notes: F59C.2. External left primer: AATGAGCTTGTTTGGATGGG. External right primer: GCTTCGAGGAAGAAACGAGA. Internal left primer: GCACAACCAGAGAGAAAGGC. Internal right primer: CCATCTCACCAAGCCCTAAC. Internal WT amplicon: 1657 bp. Deletion size: 605 bp. Deletion left flank: CGTTTTGTGCTCCTTATCTACATTTACTAC. Deletion right flank: GCTGGCCTCCATATTGTTTTAATAGATATT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037197 Copy
http://www.wormbase.org/db/get?name=WBStrain00037114
Source Database: WormBase (WB)
Affected Genes: WBGene00011737(sqst-1)
Genomic Alteration: WBGene00011737(sqst-1)
Availability: available
Source References: EMPTY
Synonyms: T12G3.1(ok2869) IV.
Alternate IDs: WB-STRAIN:VC2149, CGC_VC2149
Notes: Made_by: Vancouver KO Group|"T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 406 bp. Deletion left flank: CCACTCCAGTTCCATTCCCTCCATCTCCAA. Deletion right flank: GAAATCTGCCGAGAGACTATTCACAATGCA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037114 Copy
http://www.wormbase.org/db/get?name=WBStrain00037115
Source Database: WormBase (WB)
Affected Genes: WBGene00007372(C06B8.7)
Genomic Alteration: WBGene00007372(C06B8.7)
Availability: available
Source References: EMPTY
Synonyms: C06B8.7(ok2814) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2150, CGC_VC2150
Notes: C06B8.7. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2814 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 680 bp. Deletion left flank: GCTTAAAGCAGGAGAGACCAAAGCGTGCTT. Deletion right flank: TCTCCGAATGATCGTATCACACTGGCCAAC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037115 Copy
http://www.wormbase.org/db/get?name=WBStrain00037113
Source Database: WormBase (WB)
Affected Genes: WBGene00009081(F23B12.4)
Genomic Alteration: WBGene00009081(F23B12.4)
Availability: available
Source References: EMPTY
Synonyms: F23B12.4(ok2848) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2148, CGC_VC2148
Notes: F23B12.4. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2848 homozygotes (Dpy hermaphrodite, strongly Him, males more WT. Healthy gravid WT non-GFP segregants are recombinants and not true homozygotes). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCGCATTTGAAAGTATGA. External right primer: AAGCAAAAAGCAATGCAGGT. Internal left primer: GCAGTTGAACATCAGGGAGG. Internal right primer: GGACGCCTACGCACAATACT. Internal WT amplicon: 1145 bp. Deletion size: 396 bp. Deletion left flank: TACTACTTGAAAATGCTTCGTTAAAAATGA. Deletion right flank: GGAACTTCTAACAACAATTATATTCGACTG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037113 Copy
http://www.wormbase.org/db/get?name=WBStrain00037118
Source Database: WormBase (WB)
Affected Genes: WBGene00008881(F16B12.5)
Genomic Alteration: WBGene00008881(F16B12.5)
Availability: available
Source References: EMPTY
Synonyms: F16B12.5(gk1009) X.
Alternate IDs: WB-STRAIN:VC2154, CGC_VC2154
Notes: F16B12.5. External left primer: AATTGTACGGCGGAAAACTG. External right primer: ACCACGGTTGCATAGGACTC. Internal left primer: CTTGGCAAGACAAATGATCG. Internal right primer: CTGGACGGGTCAGTTTCAAT. Internal WT amplicon: 2766 bp. Deletion size: 1271 bp. Deletion left flank: GCATTTGGTCTCAATGAAAAAAAGAATCAG. Deletion right flank: TTAATTAGTACCACATTTAGGATGCAAAAA. Insertion Sequence: AAAAAGAAAACA.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037118 Copy
http://www.wormbase.org/db/get?name=WBStrain00037119
Source Database: WormBase (WB)
Affected Genes: WBGene00019598(K09H9.7)
Genomic Alteration: WBGene00019598(K09H9.7)
Availability: available
Source References: EMPTY
Synonyms: K09H9.7(gk1080) I.
Alternate IDs: WB-STRAIN:VC2155, CGC_VC2155
Notes: K09H9.7. External left primer: TTGTGGAAACGGCTTAGACC. External right primer: AAACATTTCGAATTACGCCG. Internal left primer: GCGGTGAATCAGGAGATGAT. Internal right primer: TTTCAGGAAACCAGCGATTC. Internal WT amplicon: 1078 bp. Deletion size: 246 bp. Deletion left flank: TTCTTCGTCTGCGGTGAATCAGGAGATGAT. Deletion right flank: ACCTTAATATATCAATTAATAAAGGTATAG.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037119 Copy
http://www.wormbase.org/db/get?name=WBStrain00037116
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00008457(E02H1.5)|WBGene00008458(E02H1.6)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00008457(E02H1.5), WBGene00008458(E02H1.6)
Availability: available
Source References: EMPTY
Synonyms: E02H1.5&E02H1.6(ok2819)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2151, CGC_VC2151
Notes: E02H1.5, E02H1.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2819 homozygotes (late larval arrest or sterile with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGACGTCGGTTTATGCAGC. External right primer: CCATGGTGTGCTCATTTTTG. Internal left primer: CCGGCATTCAAGTCAAATCT. Internal right primer: GGCAAGTTCGCAGATTCTTT. Internal WT amplicon: 2609 bp. Deletion size: 1622 bp. Deletion left flank: ACAATAATTAACCAAATTCCAGACGATAAT. Deletion right flank: CATTTCAGATCGTTTGGACAGTGATGAAGG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037116 Copy
http://www.wormbase.org/db/get?name=WBStrain00037121
Source Database: WormBase (WB)
Affected Genes: WBGene00001911(his-37)
Genomic Alteration: WBGene00001911(his-37)
Availability: available
Source References: EMPTY
Synonyms: his-37(gk1002) V.
Alternate IDs: WB-STRAIN:VC2157, CGC_VC2157
Notes: C50F4.7. External left primer: GATCCAGAGCTTCTCGCAGT. External right primer: ACAATTCCAGGTGGACAAGC. Internal left primer: TCTTCACCGTCTTTCCGAAC. Internal right primer: ATGGTTGGTAGCCACTGCTT. Internal WT amplicon: 820 bp. Deletion size: 317 bp. Deletion left flank: TCGTTTTCTAACAACTTTTAATCATGTCTG. Deletion right flank: CGATGGACGTTGTCTATGCCTTGAAACGTC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037121 Copy
http://www.wormbase.org/db/get?name=WBStrain00037122
Source Database: WormBase (WB)
Affected Genes: WBGene00016935(ifta-1)
Genomic Alteration: WBGene00016935(ifta-1)
Availability: available
Source References: EMPTY
Synonyms: ifta-1(gk1004) X.
Alternate IDs: WB-STRAIN:VC2158, CGC_VC2158
Notes: C54G7,4. External left primer: ACAATCGGAAAATTGCCAAG. External right primer: TAGATTACGCGGAGCGAAGT. Internal left primer: TTCCATATCGTGACACAGCG. Internal right primer: CCACGCCCTCAGTAAGGTAA. Internal WT amplicon: 2412 bp. Deletion size: 679 bp. Deletion left flank: TGATTTGCATCAGCGATGAATTGTGCTTTC. Deletion right flank: CACACTCAAAACCTTTCAGTACTTCATTAG. Insertion Sequence: GTGTGACCAAGCTGTTGAATGCTATTTAAGACGGAGCCTGCCACAGAAAGCATTGCACG CGTGTAAAGAGCTGAATCAGTGG.|"C54G7,4. External left primer: ACAATCGGAAAATTGCCAAG. External right primer: TAGATTACGCGGAGCGAAGT. Internal left primer: TTCCATATCGTGACACAGCG. Internal right primer: CCACGCCCTCAGTAAGGTAA. Internal WT amplicon: 2412 bp. Deletion size: 679 bp. Deletion left flank: TGATTTGCATCAGCGATGAATTGTGCTTTC. Deletion right flank: CACACTCAAAACCTTTCAGTACTTCATTAG. Insertion Sequence: GTGTGACCAAGCTGTTGAATGCTATTTAAGACGGAGCCTGCCACAGAAAGCATTGCACGCGTGTAAAGAGCTGAATCAGTGG."|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037122 Copy
http://www.wormbase.org/db/get?name=WBStrain00037120
Source Database: WormBase (WB)
Affected Genes: WBGene00010329(pcdr-1)
Genomic Alteration: WBGene00010329(pcdr-1)
Availability: available
Source References: EMPTY
Synonyms: F59D12.1(gk1000) X.
Alternate IDs: WB-STRAIN:VC2156, CGC_VC2156
Notes: F59D12.1. External left primer: CTCACAAAAAGGGGCGAATA. External right primer: TACCCCTTACACTAACGGCG. Internal left primer: GGTTGTGTTCTATCCCGACG. Internal right primer: ATGAGTGCTTGGGACTTTGG. Internal WT amplicon: 937 bp. Deletion size: 198 bp. Deletion left flank: CTTTAACACAGGCTGGAAAATCTGGTCAGC. Deletion right flank: CCATTTGATATGGATTTATCAATGGTAAGT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037120 Copy
http://www.wormbase.org/db/get?name=WBStrain00037169
Source Database: WormBase (WB)
Affected Genes: WBGene00007533(cbl-1)
Genomic Alteration: WBGene00007533(cbl-1)
Availability: available
Source References: EMPTY
Synonyms: C12C8.2(ok2954) I.
Alternate IDs: WB-STRAIN:VC2210, CGC_VC2210
Notes: C12C8.2. External left primer: GATGCGGAAATCCAACAACT. External right primer: TCAAATGCAATCATTCCAGC. Internal left primer: AATGAGATAGAAGGCGGTGC. Internal right primer: GCATATTGATGCTGTGGGTG. Internal WT amplicon: 1191 bp. Deletion size: 694 bp. Deletion left flank: CTGTTGACGTTGAAAAAGAAAAGGATTTTG. Deletion right flank: AGTTGTTACAGTATCATCTTATGATAATTG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037169 Copy
http://www.wormbase.org/db/get?name=WBStrain00037200
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: F28H6(gk959) X.
Alternate IDs: WB-STRAIN:VC2247, CGC_VC2247
Notes: F28H6. External left primer: TAAATGATTGCGCCATTTCA. External right primer: TAAAAATCACCTTCCGCCAG. Internal left primer: TTCCACATCACGCAGCTTAC. Internal right primer: TTCCCTCGAATTCACATTCC. Internal WT amplicon: 2143 bp. Deletion size: 748 bp. Deletion left flank: GAACAAAATTGTAGAAAACCCAACTTGGTA. Deletion right flank: ACTCTTTTTACATTAAGTCCCACATTTCCT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037200 Copy
http://www.wormbase.org/db/get?name=WBStrain00037168
Source Database: WormBase (WB)
Affected Genes: WBGene00022106(lgc-46)
Genomic Alteration: WBGene00022106(lgc-46)
Availability: available
Source References: EMPTY
Synonyms: lgc-46(ok2949) III.
Alternate IDs: WB-STRAIN:VC2209, CGC_VC2209
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y71D11A.5. External left primer: CCAGTTTCAGCTGTGTCGAA. External right primer: GTTTTGCACGTACTTCCACG. Internal left primer: AAACTAGGCTTGTTGGGGGT. Internal right primer: CGAAGCTAATAATGGTGCCAA. Internal WT amplicon: 1314 bp. Deletion size: 492 bp. Deletion left flank: TCCCGGGAGAGGTAGCCGACCCAGGCGAGT. Deletion right flank: AACTCCCACGAATTTCTAGATAAACTCACT. Insertion Sequence: CCCACGAATTTCTAGATA."
Proper citation: RRID:WB-STRAIN:WBStrain00037168 Copy
http://www.wormbase.org/db/get?name=WBStrain00037172
Source Database: WormBase (WB)
Affected Genes: WBGene00016918(test-1)
Genomic Alteration: WBGene00016918(test-1)
Availability: available
Source References: EMPTY
Synonyms: C54E4.2(gk1003) IV.
Alternate IDs: WB-STRAIN:VC2213, CGC_VC2213
Notes: C54E4.2. External left primer: TTTTTGACGACCAACCAACA. External right primer: CGAGGCTCTTTACGCAATTC. Internal left primer: CGCAGCGAACAAAGTTATGA. Internal right primer: CGTGGCGAGACCTATAAAGC. Internal WT amplicon: 1288 bp. Deletion size: 469 bp. Deletion left flank: TTTTTTTTTTTGGAGCTTCAGTTGAAGTTG. Deletion right flank: AGTCTCAGGAATGCAATTATAATTAGATAT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037172 Copy
http://www.wormbase.org/db/get?name=WBStrain00037170
Source Database: WormBase (WB)
Affected Genes: WBGene00004170(pqn-90)
Genomic Alteration: WBGene00004170(pqn-90)
Availability: available
Source References: EMPTY
Synonyms: pqn-90(gk989) IV.
Alternate IDs: WB-STRAIN:VC2211, CGC_VC2211
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y73F8A.8. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 519 bp. Deletion left flank: AAGCTGGTGCAGATGGAAGTGTGCATTGTG. Deletion right flank: AAGATTGACACTCATTCATAGATGGAGCAA. Insertion Sequence: ATTGACACTCATTC."
Proper citation: RRID:WB-STRAIN:WBStrain00037170 Copy
http://www.wormbase.org/db/get?name=WBStrain00037176
Source Database: WormBase (WB)
Affected Genes: WBGene00001063(dpy-1)|WBGene00019212(zmp-2)
Genomic Alteration: WBGene00001063(dpy-1), WBGene00019212(zmp-2)
Availability: available
Source References: EMPTY
Synonyms: H19M22.3(ok2827)/sC1 [dpy-1(s2170)] III.
Alternate IDs: WB-STRAIN:VC2218, CGC_VC2218
Notes: H19M22.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2827 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCCGTGACGCTTAAATGG. External right primer: ATAATTCAGTGCCCGAGAGC. Internal left primer: ATCTCCGACTACACCAGCGA. Internal right primer: AGCGTCCGTTGACTTGAGTT. Internal WT amplicon: 1135 bp. Deletion size: 538 bp. Deletion left flank: AGAAAAAAATCTAGCAGATTGCAAAATCTA. Deletion right flank: AGTGTGCAGTGAGCAGCTGCTGCGACAAGG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037176 Copy
http://www.wormbase.org/db/get?name=WBStrain00037175
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00019630(emb-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00019630(emb-1)
Availability: available
Source References: EMPTY
Synonyms: K10D2.4(ok2759) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2216, CGC_VC2216
Notes: K10D2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2759 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 658 bp. Deletion left flank: TTAAAATCTCAGCGGGAGTTTGATCAAATT. Deletion right flank: CATTGGGAAAGACGAACCGAATAATAGGTA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037175 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.