Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00005042
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004897(snb-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004897(snb-1)
Availability: unknown
Source References: PMID:21123567
Synonyms: [Psnb-1::TDP-43(+), Pmyo-2::dsRED]
Alternate IDs: WB-STRAIN:CK405
Notes: Psnb-1::TDP-43 (WT)|"[2020-05-27T21:00:18.108Z WBPerson324] Adding data Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(+), Pmyo-2::dsRED] Description: expresses pan-neuronal human wild-type TDP-43 cDNA (NM_007375) and a Pmyo-2::dsRED coinjection marker."
Proper citation: RRID:WB-STRAIN:WBStrain00005042 Copy
http://www.wormbase.org/db/get?name=WBStrain00005040
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:22611162, PMID:33318982, PMID:37000013
Synonyms: bkIs10 [Paex-3::h4R1NTauV337M; Pmyo-2::gfp]
Alternate IDs: WB-STRAIN:CK10
Notes: bkIs10[Paex-3::h4R1NTauV337M;Pmyo-2::gfp]|"expressing human 1N4R tau with a V337M mutation"|"WBStrain mapped, WBPaper00059548 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060449 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060456 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060486 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060545 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060669 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060692 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060778 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060797 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060840 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060924 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060976 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061045 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061159 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061236 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061385 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061436 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061452 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061495 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061547 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061584 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061641 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061671 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061869 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061871 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061890 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061895 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061902 added based on AFP_Strain data."|"[2020-09-16T20:51:17.431Z WBPerson324] Ressurect Strain: Genotype: bkIs10 [Paex-3::h4R1NTauV337M; Pmyo-2::gfp]"
Proper citation: RRID:WB-STRAIN:WBStrain00005040 Copy
http://www.wormbase.org/db/get?name=WBStrain00005038
Source Database: WormBase (WB)
Affected Genes: WBGene00000961(dgn-1)
Genomic Alteration: WBGene00000961(dgn-1)
Availability: available
Synonyms: dgn-1(cg121) X; cgEx308.
Alternate IDs: WB-STRAIN:CH1869, CGC_CH1869
Notes: cgEx308 [dgn-1(+) + dng-1p::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate.|"Made_by: Robert Johnson"
Proper citation: RRID:WB-STRAIN:WBStrain00005038 Copy
http://www.wormbase.org/db/get?name=WBStrain00005039
Source Database: WormBase (WB)
Affected Genes: WBGene00000961(dgn-1)|WBGene00017221(dgn-3)|WBGene00018943(dgn-2)
Genomic Alteration: WBGene00000961(dgn-1), WBGene00017221(dgn-3), WBGene00018943(dgn-2)
Availability: available
Source References: PMID:38177158
Synonyms: dgn-2(ok209) dgn-3(tm1092) dgn-1(cg121) X; cgEx308.
Alternate IDs: WB-STRAIN:CH1878, CGC_CH1878
Notes: cgEx308 [pJK600/dgn-1(+) + pJK602/dng-1p::GFP + rol-6(su1066)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-2 dgn-3 dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate. Triple mutants resemble dgn-1 single mutants; no overt phenotype caused by dgn-2 dgn-3 mutations.
Proper citation: RRID:WB-STRAIN:WBStrain00005039 Copy
http://www.wormbase.org/db/get?name=WBStrain00005054
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:29409526
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CK1044
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005054 Copy
http://www.wormbase.org/db/get?name=WBStrain00005053
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:29409526
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CK646
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005053 Copy
http://www.wormbase.org/db/get?name=WBStrain00005051
Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CK511
Notes: Psnb-1::TDP-43 (G290A, S409A/S410A)
Proper citation: RRID:WB-STRAIN:WBStrain00005051 Copy
http://www.wormbase.org/db/get?name=WBStrain00005047
Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CK505
Notes: Psnb-1::TDP-43 (M337V, S409A/S410A)
Proper citation: RRID:WB-STRAIN:WBStrain00005047 Copy
http://www.wormbase.org/db/get?name=WBStrain00005048
Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CK506
Notes: Psnb-1::TDP-43 (M337V, S409A/S410A)
Proper citation: RRID:WB-STRAIN:WBStrain00005048 Copy
http://www.wormbase.org/db/get?name=WBStrain00005067
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:9751195
Synonyms: N2; dvEx102 [pDF4 (unc-54/b 1-42 A30P) + pRF4
Alternate IDs: WB-STRAIN:CL1102
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005067 Copy
http://www.wormbase.org/db/get?name=WBStrain00005100
Source Database: WormBase (WB)
Availability: available
Source References: PMID:9751195
Synonyms: Punc-54::human Amyloid beta 1-42; mtl-2::gfp
Alternate IDs: WB-STRAIN:CL2120, CGC_CL2120
Notes: dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures.|"[2020-08-03T20:28:08.764Z WBPerson324] Ressurect Strain: Genotype: Punc-54::human Amyloid beta 1-42; mtl-2::gfp"
Proper citation: RRID:WB-STRAIN:WBStrain00005100 Copy
http://www.wormbase.org/db/get?name=WBStrain00005068
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:9751195
Synonyms: N2; dvEx103 [pDF4 (unc-54/b 1-42 A30P) + pCL26, inj.2]
Alternate IDs: WB-STRAIN:CL1103
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005068 Copy
http://www.wormbase.org/db/get?name=WBStrain00005065
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:19414486
Synonyms: smg-1 ts(cc546)I, dvIs27 [pAF29 (myo-3/B1-42/letUTR) + pFR4]; smg-1(cc546); dvEx494 [pCL195 (myo-3/aip-1) + pCL148 (myo-3/DsRed Monomer)]
Alternate IDs: WB-STRAIN:CL859
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005065 Copy
http://www.wormbase.org/db/get?name=WBStrain00005061
Source Database: WormBase (WB)
Affected Genes: WBGene00004804(skn-1)
Genomic Alteration: WBGene00004804(skn-1)
Availability: available
Synonyms: dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V).
Alternate IDs: WB-STRAIN:CL691, CGC_CL691
Notes: dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.|"Mutagen:Gamma rays"
Proper citation: RRID:WB-STRAIN:WBStrain00005061 Copy
http://www.wormbase.org/db/get?name=WBStrain00005062
Source Database: WormBase (WB)
Affected Genes: WBGene00004397(rol-6)|WBGene00004879(smg-1)
Genomic Alteration: WBGene00004397(rol-6), WBGene00004879(smg-1)
Availability: available
Source References: PMID:32966472, PMID:37726773, PMID:38983916
Synonyms: smg-1(cc546) I; rol-6(su1006) II.
Alternate IDs: WB-STRAIN:CL802, CGC_CL802
Notes: Rollers. Maintain under normal conditions. Standard control for CL4176; originally used CL1175 as the control, but subsequently it was found that CL1175 can produce some A-Beta. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Supplementary_genotype [smg-1(cc546) I; rol-6(su1006) II]"|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005062 Copy
http://www.wormbase.org/db/get?name=WBStrain00005060
Source Database: WormBase (WB)
Availability: unknown
Synonyms: par-1 (zu310ts) V
Alternate IDs: WB-STRAIN:CL522
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005060 Copy
http://www.wormbase.org/db/get?name=WBStrain00005059
Source Database: WormBase (WB)
Affected Genes: WBGene00005157(srf-8)
Genomic Alteration: WBGene00005157(srf-8)
Availability: available
Source References: PMID:1516818
Synonyms: srf-8(dv38) V.
Alternate IDs: WB-STRAIN:CL264, CGC_CL264
Notes: Animals are somewhat smaller than WT. Often have protuding vulva. Unc(slow moving and non-sinusoidal body posture). Egl. Males are infertile and Mab. Ectopic surface binding of lectins WGA and SBA.
Proper citation: RRID:WB-STRAIN:WBStrain00005059 Copy
http://www.wormbase.org/db/get?name=WBStrain00005111
Source Database: WormBase (WB)
Affected Genes: WBGene00001752(gst-4)
Genomic Alteration: WBGene00001752(gst-4)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CL3166
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005111 Copy
http://www.wormbase.org/db/get?name=WBStrain00005199
Source Database: WormBase (WB)
Affected Genes: WBGene00006808(unc-76)
Genomic Alteration: WBGene00006808(unc-76)
Availability: available
Synonyms: unc-76(e911) V; smIs380.
Alternate IDs: WB-STRAIN:CU9087, CGC_CU9087
Notes: Made_by: Jim Mapes|"Mutagen:Gamma rays"|"smIs380 [tra-2::GFP + unc-76(+)]. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press."
Proper citation: RRID:WB-STRAIN:WBStrain00005199 Copy
http://www.wormbase.org/db/get?name=WBStrain00005197
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001168(eef-1A.1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001168(eef-1A.1)
Availability: available
Synonyms: eef-1A.1(q145) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:CU6493, CGC_CU6493
Notes: Heterozygotes are WT and GFP+. Segregate non-GFP steriles (q145 homozygotes). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
Proper citation: RRID:WB-STRAIN:WBStrain00005197 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
