Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00004994
Source Database: WormBase (WB)
Affected Genes: WBGene00001066(dpy-4)|WBGene00006766(unc-30)
Genomic Alteration: WBGene00001066(dpy-4), WBGene00006766(unc-30)
Availability: available
Synonyms: unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs50] (IV;V;f).
Alternate IDs: WB-STRAIN:CGC64, CGC_CGC64
Notes: umnIs50 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type mKate2+; animals that have lost the Dup are Dpy Unc mKate2-. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004994 Copy
http://www.wormbase.org/db/get?name=WBStrain00004993
Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006745(unc-5)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006745(unc-5)
Availability: available
Synonyms: unc-5(e53)/nT1 [umnIs49] IV; dpy-11(e224)/nT1 V.
Alternate IDs: WB-STRAIN:CGC63, CGC_CGC63
Notes: umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004993 Copy
http://www.wormbase.org/db/get?name=WBStrain00004929
Source Database: WormBase (WB)
Affected Genes: WBGene00001171(egl-2)|WBGene00001864(him-5)|WBGene00006830(unc-103)
Genomic Alteration: WBGene00001171(egl-2), WBGene00001864(him-5), WBGene00006830(unc-103)
Availability: available
Synonyms: unc-103(n1213) III; egl-2(rg4) him-5(e1490) V; rgEx173.
Alternate IDs: WB-STRAIN:CG490, CGC_CG490
Notes: rgEx173 [unc-103ep::egl-2(cDNA) + gtl-1p::CFP]. Pick animals with cyan fluorescence in their intestines. rgEx173 rescues food deprivation's ability to suppress unc-103(n1213)-induced male sex muscle seizures.
Proper citation: RRID:WB-STRAIN:WBStrain00004929 Copy
http://www.wormbase.org/db/get?name=WBStrain00004928
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00006779(unc-43)
Genomic Alteration: WBGene00001864(him-5), WBGene00006779(unc-43)
Availability: available
Synonyms: unc-43(sy574) IV; him-5(e1490) V; rgEx161.
Alternate IDs: WB-STRAIN:CG460, CGC_CG460
Notes: rgEx161[lev-11p::UNC-43g + gtl-1p::CFP]. rgEx161 rescues unc-43(sy574)-induced spicule protraction.
Proper citation: RRID:WB-STRAIN:WBStrain00004928 Copy
http://www.wormbase.org/db/get?name=WBStrain00004925
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00006779(unc-43)
Genomic Alteration: WBGene00001864(him-5), WBGene00006779(unc-43)
Availability: available
Synonyms: unc-43(sy574) IV; him-5(e1490) V.
Alternate IDs: WB-STRAIN:CG118, CGC_CG118
Notes: Males constitutively protract their spicules in the absence of mating cues.
Proper citation: RRID:WB-STRAIN:WBStrain00004925 Copy
http://www.wormbase.org/db/get?name=WBStrain00004922
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32550378
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CF4138
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00004922 Copy
http://www.wormbase.org/db/get?name=WBStrain00004920
Source Database: WormBase (WB)
Availability: available
Source References: PMID:37708127
Synonyms: muEx473.
Alternate IDs: WB-STRAIN:CF3166, CGC_CF3166
Notes: muEx473 [kin-19p::kin-19::tagRFP + tph-1p::GFP]. Pick RFP+ GFP+ animals to maintain. Low transmission rate. Translational fusion of KIN-19 displaying age-dependent aggregation. Reference: David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.
Proper citation: RRID:WB-STRAIN:WBStrain00004920 Copy
http://www.wormbase.org/db/get?name=WBStrain00005076
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:9751195
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CL1116
Notes: Lost before successful freezing
Proper citation: RRID:WB-STRAIN:WBStrain00005076 Copy
http://www.wormbase.org/db/get?name=WBStrain00005077
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:9751195
Synonyms: N2; dvEx117 [pDF7 (unc-54/b 1-40 M35C) + pRF4
Alternate IDs: WB-STRAIN:CL1117
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005077 Copy
http://www.wormbase.org/db/get?name=WBStrain00005071
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:9751195
Synonyms: N2; dvEx111 [pDF2 (unc-54/b 1-42 L17P) + pRF4
Alternate IDs: WB-STRAIN:CL1111
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005071 Copy
http://www.wormbase.org/db/get?name=WBStrain00005069
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:9751195
Synonyms: N2; dvEx105 [pDF4 (unc-54/b 1-42 A30P) + pCL26
Alternate IDs: WB-STRAIN:CL1105
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005069 Copy
http://www.wormbase.org/db/get?name=WBStrain00005002
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021328(npr-23)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021328(npr-23)
Availability: available
Synonyms: npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Alternate IDs: WB-STRAIN:CGC72, CGC_CGC72
Notes: Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of npr-23. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: cccctgcctctggctcccacaaggcgtcatctggagagaagaacgaagtg Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGCGTTGCTCGTATTGGTGCCGG"
Proper citation: RRID:WB-STRAIN:WBStrain00005002 Copy
http://www.wormbase.org/db/get?name=WBStrain00005087
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:9751195
Synonyms: N2; dvEx130 [pDF2 (unc-54/b 1-42 M35C) + pCL26 inj 3]
Alternate IDs: WB-STRAIN:CL1130
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005087 Copy
http://www.wormbase.org/db/get?name=WBStrain00005085
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:9751195
Synonyms: N2; dvEx128 [pDF2 (unc-54/b 1-42 L17P) + pCL26 inj 4]
Alternate IDs: WB-STRAIN:CL1128
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005085 Copy
http://www.wormbase.org/db/get?name=WBStrain00005081
Source Database: WormBase (WB)
Affected Genes: WBGene00003474(mtl-2)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003474(mtl-2), WBGene00006789(unc-54)
Availability: unknown
Source References: PMID:9751195
Synonyms: N2; dvEx121 [pCL12 (unc-54/b 1-42) + pCL26
Alternate IDs: WB-STRAIN:CL1121
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005081 Copy
http://www.wormbase.org/db/get?name=WBStrain00005082
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:9751195
Synonyms: N2; dvEx122 [pPD30.38 (unc-54 vector) + pCL26
Alternate IDs: WB-STRAIN:CL1122
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005082 Copy
http://www.wormbase.org/db/get?name=WBStrain00005013
Source Database: WormBase (WB)
Availability: available
Synonyms: umnIs65 V.
Alternate IDs: WB-STRAIN:CGC84, CGC_CGC84
Notes: Made_by: Emily Lorenz-Mueller|"umnIs65 [myo-2p::mKate2 + NeoR, V:4308261 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9."
Proper citation: RRID:WB-STRAIN:WBStrain00005013 Copy
http://www.wormbase.org/db/get?name=WBStrain00005098
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:9751195
Synonyms: dvIs8 [integrated unc-54/b 1-42 A30P (pDF4) + pRF4
Alternate IDs: WB-STRAIN:CL2085
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005098 Copy
http://www.wormbase.org/db/get?name=WBStrain00005094
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:7568134, PMID:9751195, PMID:32966472, PMID:34707479, PMID:36226991, PMID:36653384, PMID:37103980, PMID:37522064, PMID:37113386, PMID:37549461, PMID:38983916, PMID:38991033, PMID:39950089
Synonyms: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Alternate IDs: WB-STRAIN:CL2006, CGC_CL2006
Notes: dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005.|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062076 paper added based on AFP_Strain data."|"[2020-08-03T18:23:09.013Z WBPerson324] Ressurect Strain: Paper: WBPaper00002289 Genotype: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]"
Proper citation: RRID:WB-STRAIN:WBStrain00005094 Copy
http://www.wormbase.org/db/get?name=WBStrain00005095
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)
Genomic Alteration: WBGene00001864(him-5)
Availability: available
Source References: PMID:7568134
Synonyms: unc-54p::human transthyretin::rol-6 (su1006)
Alternate IDs: WB-STRAIN:CL2008, CGC_CL2008
Notes: dvIs3 [unc-54p::human transthyretin + rol-6(su1006)]. Rollers. Him. Expression of wild-type human transthyretin (TTR) in body wall muscles. Transthyretin is secreted from the muscles into the pseudocoelom and concentrates in the coelomocytes. Reference: Link CD (1995) Proc Natl Acad Sci U S A 92:9368-9372.|"Mutagen:Gamma radiation"|"[2020-08-03T20:19:01.738Z WBPerson324] Ressurect Strain: WBPaper00002289 Genotype: unc-54p::human transthyretin::rol-6 (su1006)"
Proper citation: RRID:WB-STRAIN:WBStrain00005095 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
