Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00023905

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00002732(let-542)|WBGene00003056(lon-2)|WBGene00006752(unc-13)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002732(let-542), WBGene00003056(lon-2), WBGene00006752(unc-13), WBGene00006765(unc-29)
Availability: available
Source References: PMID:9230900
Synonyms: dpy-5(e61) let-542(h986) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:KR1594, CGC_KR1594
Notes: Heterozygotes are WT and segregate WT, arrested DpyUncs, Lon males and large number of aneuploid progeny (arrested embyros or larvae). Note that unc-29 is outside the recombination-suppressed region of szT1 and may cross off resulting in Unc-29 progeny. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Proper citation: RRID:WB-STRAIN:WBStrain00023905 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00023933

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2249758
Synonyms: hDf6 dpy-5(e61) unc-13(e450) I; hDp31 (I;f).
Alternate IDs: WB-STRAIN:KR1737, CGC_KR1737
Notes: Unc strain that throws Uncs and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Proper citation: RRID:WB-STRAIN:WBStrain00023933 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00023934

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
Source References: PMID:1603066
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp64 (I;f).
Alternate IDs: WB-STRAIN:KR1744, CGC_KR1744
Notes: This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Proper citation: RRID:WB-STRAIN:WBStrain00023934 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00023937

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
Source References: PMID:1603066
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp62 (I;f).
Alternate IDs: WB-STRAIN:KR1758, CGC_KR1758
Notes: This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Proper citation: RRID:WB-STRAIN:WBStrain00023937 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00023922

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00002700(let-508)|WBGene00003056(lon-2)|WBGene00006752(unc-13)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002700(let-508), WBGene00003056(lon-2), WBGene00006752(unc-13), WBGene00006765(unc-29)
Availability: available
Source References: PMID:2249758
Synonyms: let-508(h995) dpy-5(e61) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:KR1694, CGC_KR1694
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00023922 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00023920

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) unc-13(e450) I; hDp61 (I;f).
Alternate IDs: WB-STRAIN:KR1673, CGC_KR1673
Notes: 1500 R gamma|"Made_by: McKim K"|"Mutagen:Gamma rays"|"Unc-13 phenotype. Segregates Unc-13 and Dpy-5 Unc-13. Pick Unc-13 and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."

Proper citation: RRID:WB-STRAIN:WBStrain00023920 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00023940

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
Source References: PMID:1603066
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp36 (I;f).
Alternate IDs: WB-STRAIN:KR1780, CGC_KR1780
Notes: This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Proper citation: RRID:WB-STRAIN:WBStrain00023940 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00033500

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003934(pat-10)|WBGene00006774(unc-38)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003934(pat-10), WBGene00006774(unc-38)
Availability: available
Source References: PMID:8106547
Synonyms: unc-38(x20) pat-10(st568)/unc-38(x20) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:RW1383, CGC_RW1383
Notes: Heterozygotes are Unc non-Dpy and segregate Unc non-Dpy, DpyUnc and PATs. st568 is a recessive lethal causing a PAT phenotype (paralyzed embryoes, arrested elongation at 2-fold length).

Proper citation: RRID:WB-STRAIN:WBStrain00033500 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00033517

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003935(pat-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003935(pat-11)
Availability: available
Source References: PMID:8106547
Synonyms: pat-11(st541)/dpy-5(e61) I.
Alternate IDs: WB-STRAIN:RW3518, CGC_RW3518
Notes: Heterozygotes are WT and segregate WT, Dpys and embryos which arrest at the 2-fold stage.

Proper citation: RRID:WB-STRAIN:WBStrain00033517 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037917

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00011971(lron-9)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00011971(lron-9)
Availability: available
Source References: EMPTY
Synonyms: lron-9(gk5062[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I.
Alternate IDs: WB-STRAIN:VC4100, CGC_VC4100
Notes: Homozygous lethal deletion balanced by tmC18. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes and Dpy non-GFP (tmC18). Deletion of 2039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTGTCGTATTTTTGTTACAGTACCTACG ; Right flanking sequence: GGTGGTTGGAAGATTCCATCAGCACGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous lethal deletion balanced by tmC18. Heterozygotes are WT with pharyngeal GFP, and segregate GFP heterozygotes, GFP gk5062 homozygotes (arrest stage undetermined), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+ to maintain. Deletion of 2039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTGTCGTATTTTTGTTACAGTACCTACG ; Right flanking sequence: GGTGGTTGGAAGATTCCATCAGCACGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037917 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034653

Source Database: WormBase (WB)
Affected Genes: WBGene00000431(ceh-6)|WBGene00001067(dpy-5)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00000431(ceh-6), WBGene00001067(dpy-5), WBGene00006765(unc-29)
Availability: available
Source References: WBPaper00014592(PMID:EMPTY)
Synonyms: ceh-6(mg60)/dpy-5(e61) unc-29(e1072) I.
Alternate IDs: WB-STRAIN:TB1, CGC_TB1
Notes: ceh-6(mg60) is lethal. Maintain by picking WT and check that it throws 1/4 Dpys. mg60 is a 1.3 kb deletion that removes part of the conserved POU-specific domain. PCR with primers PCR6-5 GAA-TTC-ATG-AAA-TCG-GAG-GCG-T (->) and PCR6-3 GTG-AGA-AGT-GAA-GAG-GAT-TGT-A (<-) yields a band of about 1.6 kb instead of 280 bp as in N2. Backcrossed more than 10 times; in addition, the left arm of LG I was recombined with lin-28 to remove the mutator locus.|"Made_by: Tom Burglin"

Proper citation: RRID:WB-STRAIN:WBStrain00034653 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00026920

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003014(lin-28)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003014(lin-28)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) lin-28(n719) I.
Alternate IDs: WB-STRAIN:MT2007, CGC_MT2007
Notes: Dpy. Egl.

Proper citation: RRID:WB-STRAIN:WBStrain00026920 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00027263

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00006753(unc-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00006753(unc-14)
Availability: available
Source References: PMID:8756352
Synonyms: dpy-5(e61) nDf43/dpy-14(e188) unc-14(e57) I.
Alternate IDs: WB-STRAIN:MT6356, CGC_MT6356
Notes: Heterozygotes are WT and segregate WT, DpyUncs and animals which arrest as L1 or L2 larvae (nDf43) homozygotes.

Proper citation: RRID:WB-STRAIN:WBStrain00027263 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00027389

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003387(mod-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003387(mod-5)
Availability: available
Source References: EMPTY
Synonyms: mod-5(n3314) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:MT11190, CGC_MT11190
Notes: Dpy. Serotonin hypersensitive. 5-HT hypersensitivity phenotype. Hyperslowing in locomotion assay.

Proper citation: RRID:WB-STRAIN:WBStrain00027389 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00027334

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003186(mek-2)|WBGene00006320(sup-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003186(mek-2), WBGene00006320(sup-11)
Availability: available
Source References: PMID:7729691
Synonyms: mek-2(n2678)/sup-11(n403) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:MT8667, CGC_MT8667
Notes: Heterozygotes are WT and segregate WT, Sterile Vuls and scrawny Dpys. n2678 is a suppressor of let-60(n1046) Muv. n2678 animals are Vul and recessive sterile. n2678 is a strong allele, probably null. See also WBPaper00002150.

Proper citation: RRID:WB-STRAIN:WBStrain00027334 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00027345

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003036(lin-53)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003036(lin-53)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) lin-53(n833) I.
Alternate IDs: WB-STRAIN:MT8840, CGC_MT8840
Notes: Dpy. n833 is a synthetic Muv with lin-15A(n767).

Proper citation: RRID:WB-STRAIN:WBStrain00027345 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00030675

Source Database: WormBase (WB)
Affected Genes: WBGene00000485(che-3)|WBGene00001067(dpy-5)
Genomic Alteration: WBGene00000485(che-3), WBGene00001067(dpy-5)
Availability: available
Source References: PMID:3596232
Synonyms: che-3(hf5) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:PH32, CGC_PH32
Notes: Dpy. Resistant to caffeine. Previously called caf-2(hf5).

Proper citation: RRID:WB-STRAIN:WBStrain00030675 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00028755

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006805(unc-73)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006805(unc-73)
Availability: available
Source References: PMID:9529254
Synonyms: dpy-5(e61)/unc-73(gm40) I.
Alternate IDs: WB-STRAIN:NG2837, CGC_NG2837
Notes: Heterozgyotes are WT and segregate WT, Dpys and Uncs. Recombination occurs in this strain so pick individual WT animals and score the progeny for both Dpys and Uncs.

Proper citation: RRID:WB-STRAIN:WBStrain00028755 Copy   

•   Source: Integrated Animals