Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
GS305 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007986 | Caenorhabditis elegans | evl-17(ar94)/dpy-5(e61) unc-13(e51) I. | Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. | WBGene00001067(dpy-5)|WBGene00001355(evl-17)|WBGene00006752(unc-13) | WBGene00001067(dpy-5), WBGene00001355(evl-17), WBGene00006752(unc-13) | WB-STRAIN:WBStrain00007986 | WormBase (WB) | WB | available | PMID:8500652 | WB-STRAIN:GS305, CGC_GS305 | 2026-08-08 10:08:49 | 0 | ||
|
GS454 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008014 | Caenorhabditis elegans | evl-9(ar121)/dpy-5(e61) unc-13(e51) I. | Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. | WBGene00001067(dpy-5)|WBGene00001349(evl-9)|WBGene00006752(unc-13) | WBGene00001067(dpy-5), WBGene00001349(evl-9), WBGene00006752(unc-13) | WB-STRAIN:WBStrain00008014 | WormBase (WB) | WB | available | PMID:8500652 | WB-STRAIN:GS454, CGC_GS454 | 2026-08-08 10:08:50 | 0 | ||
|
HR10 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00008442 | Caenorhabditis elegans | dhc-1(ct42) dpy-5(e61)/unc-11(e47) bli-4(e937) I. | Heterozygtes are WT. Hets segregate WT, UncBli and DpyLet. ct42 homozygotes are inviable at all temperatures (recessive non-conditional larval lethal). ct42 is dominant temperature sensitive maternal effect lethal. ct42 hets give more inviable progeny at 25C than at 15C. dch-1 was previously called let-354(ct42).|"Made_by: Mains P" | WBGene00000254(bli-4)|WBGene00000962(dhc-1)|WBGene00001067(dpy-5)|WBGene00006751(unc-11) | WBGene00000254(bli-4), WBGene00000962(dhc-1), WBGene00001067(dpy-5), WBGene00006751(unc-11) | WB-STRAIN:WBStrain00008442 | WormBase (WB) | WB | available | PMID:2379819 | WB-STRAIN:HR10, CGC_HR10 | 2026-08-08 10:08:54 | 0 | ||
|
rab-5(udn11)/tmC18 [dpy-5(tmIs1200)] I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052037 | Caenorhabditis elegans | rab-5(udn11)/tmC18 [dpy-5(tmIs1200)] I. | Made_by: UDN Screening Center|"rab-5 [D135D]. Silent BstAPI site added in D135D allele for ease of genotyping. Balancer marked with myo-2p::Venus. Reference: Huang et al. 2022. PMID: 35121658" | WBGene00001067(dpy-5)|WBGene00004268(rab-5) | WBGene00001067(dpy-5), WBGene00004268(rab-5) | WB-STRAIN:WBStrain00052037 | WormBase (WB) | WB | unknown | 2026-08-08 10:18:45 | 0 | ||||
|
rab-5(udn47)/tmC18 [dpy-5(tmIs1200)] I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052054 | Caenorhabditis elegans | rab-5(udn47)/tmC18 [dpy-5(tmIs1200)] I. | Made_by: UDN Screening Center|"rab-5 [A29A]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29A] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn47 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [A29A] homozygotes from taking over the population and losing the balancer! Silent DdeI site added in A29A allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658" | WBGene00001067(dpy-5)|WBGene00004268(rab-5) | WBGene00001067(dpy-5), WBGene00004268(rab-5) | WB-STRAIN:WBStrain00052054 | WormBase (WB) | WB | unknown | 2026-08-08 10:18:49 | 0 | ||||
|
rab-5(udn64)/tmC18 [dpy-5(tmIs1236)] I; udnSi38 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052050 | Caenorhabditis elegans | rab-5(udn64)/tmC18 [dpy-5(tmIs1236)] I; udnSi38 II. | Made_by: UDN Screening Center|"udnSi38 [rab5p::rab-5] II. Maintain at 20 degrees. rab-5 [D135N] variant edit #2 with a single copy of wild-type rab-5 integrated into chromosome II at ttTi5605 site (II: 0.77). Homozygous lethal rab-5 [D135N] mutation balanced by tmC18. Balancer marked with myo-2p::mCherry. Heterozygotes are WT with pharyngeal mCherry fluorescence, and segregate mCherry + heterozygotes, non-mCherry rab-5 [D135N] homozygotes (L1 lethal), and Dpy mCherry+ tmC18 homozygotes. Pick fertile wild-type mCherry+ to maintain. [D135N]/ [D135N]; udnSi38/udnSi38 double homozygotes are lethal. Reference: Huang et al. 2022. PMID: 35121658" | WBGene00001067(dpy-5)|WBGene00004268(rab-5) | WBGene00001067(dpy-5), WBGene00004268(rab-5) | WB-STRAIN:WBStrain00052050 | WormBase (WB) | WB | unknown | 2026-08-08 10:18:45 | 0 | ||||
|
rab-5(udn49)/tmC18 [dpy-5(tmIs1200)] I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052049 | Caenorhabditis elegans | rab-5(udn49)/tmC18 [dpy-5(tmIs1200)] I. | Homozygous lethal rab-5 [A29P] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29P] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent DdeI site added in A29P for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658|"Made_by: UDN Screening Center" | WBGene00001067(dpy-5)|WBGene00004268(rab-5) | WBGene00001067(dpy-5), WBGene00004268(rab-5) | WB-STRAIN:WBStrain00052049 | WormBase (WB) | WB | unknown | 2026-08-08 10:18:45 | 0 | ||||
|
rab-5(udn17)/tmC18 [dpy-5(tmIs1200)] I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052038 | Caenorhabditis elegans | rab-5(udn17)/tmC18 [dpy-5(tmIs1200)] I. | Homozygous lethal rab-5 [Q78R] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78R] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent KpnI site added in Q78R for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658|"Made_by: UDN Screening Center" | WBGene00001067(dpy-5)|WBGene00004268(rab-5) | WBGene00001067(dpy-5), WBGene00004268(rab-5) | WB-STRAIN:WBStrain00052038 | WormBase (WB) | WB | unknown | 2026-08-08 10:18:45 | 0 | ||||
|
drsh-1(viz43)/tmC18[dpy-5(tmIs1200[myo-2p::mVenus])] I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054650 | Caenorhabditis elegans | drsh-1(viz43)/tmC18[dpy-5(tmIs1200[myo-2p::mVenus])] I. | Made_by: J. H. Seemann|"[D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010." | WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00009163(drsh-1) | WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00009163(drsh-1) | WB-STRAIN:WBStrain00054650 | WormBase (WB) | WB | unknown | 2026-08-08 10:19:18 | 0 | ||||
|
rnp-6(ve790[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC20 [dpy-5(tm9709)] I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055439 | Caenorhabditis elegans | rnp-6(ve790[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC20 [dpy-5(tm9709)] I. | Early larval arrest. Deletion of 7256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain KR16. unc-11 dpy-5 homozygotes no longer carrying the duplication were outcrossed 5 times to N2 to remove dpy-5; however, unc-11 may still be in the background. rnp-6 deletion was balanced over tmC20 [dpy-5(tm9709)] by crossing with strain FX30235. Balanced heterozygotes are semi-Dpy GFP+, and segregate semi-Dpy GFP+, early larval lethal GFP+ (ve790 homozygotes), and non-GFP dpy-5 animals (tmC20 homozygotes). Maintain by picking semi-dpy GFP+. Left flanking Sequence: attaaaaacatggaggaattcgagaataca ; Right flanking sequence: GCCTGTTTTCGATGTCTGCCGAGTTTTCTT. sgRNA #4: TGGAAATACTGTCAAAGCGG; sgRNA #2: AGACATCGAAAACAGGCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004389(rnp-6)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004389(rnp-6), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055439 | WormBase (WB) | WB | unknown | 2026-08-08 10:19:30 | 0 | ||||
|
dpy-5(e61) mom-4(or39) I/hT1 (I;III); him-5(e1490) V Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049794 | Caenorhabditis elegans | dpy-5(e61) mom-4(or39) I/hT1 (I;III); him-5(e1490) V | Batch Strain object requested via get_NS_ids.pl | WBGene00001067(dpy-5)|WBGene00001864(him-5)|WBGene00003396(mom-4) | WBGene00001067(dpy-5), WBGene00001864(him-5), WBGene00003396(mom-4) | WB-STRAIN:WBStrain00049794 | WormBase (WB) | WB | unknown | PMID:33713117 | 2026-08-08 10:18:16 | 0 | |||
|
src-1(syb7248)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062742 | Caenorhabditis elegans | src-1(syb7248)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. | juIs76 [unc-25p::GFP + lin-15(+)] II. D381A substitution mutation generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), embryonic lethality (syb7248 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https: | WBGene00001067(dpy-5)|WBGene00005077(src-1)|WBGene00006753(unc-14) | WBGene00001067(dpy-5), WBGene00005077(src-1), WBGene00006753(unc-14) | WB-STRAIN:WBStrain00062742 | WormBase (WB) | WB | unknown | 2026-08-08 10:21:12 | 0 | ||||
|
dpy-5::mNG(syb3312) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062924 | Caenorhabditis elegans | dpy-5::mNG(syb3312) I. | Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous dpy-5 locus." | WBGene00001067(dpy-5) | WBGene00001067(dpy-5) | WB-STRAIN:WBStrain00062924 | WormBase (WB) | WB | unknown | 2026-08-08 10:21:14 | 0 | ||||
|
rps-10(cc2557)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062917 | Caenorhabditis elegans | rps-10(cc2557)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. | Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus cc2557 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc2557 is an engineered mutation creating an early stop (T8*). Presumptive rps-10 null. Heterozygous rps-10(cc2557)/tmC20 animals are delayed in development. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.|"Made_by: Elif Sarinay Cenik & Agustian Surya" | WBGene00001067(dpy-5)|WBGene00004479(rps-10)|WBGene00006753(unc-14) | WBGene00001067(dpy-5), WBGene00004479(rps-10), WBGene00006753(unc-14) | WB-STRAIN:WBStrain00062917 | WormBase (WB) | WB | unknown | 2026-08-08 10:21:14 | 0 | ||||
|
ZZ1012 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040930 | Caenorhabditis elegans | unc-74(x19) dpy-5(e61) I. | EMPTY | WBGene00001067(dpy-5)|WBGene00006806(unc-74) | WBGene00001067(dpy-5), WBGene00006806(unc-74) | WB-STRAIN:WBStrain00040930 | WormBase (WB) | WB | available | WB-STRAIN:ZZ1012, CGC_ZZ1012 | 2026-08-08 10:16:15 | 0 | |||
|
BC11151 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00042260 | Caenorhabditis elegans | dpy-5(e907) I; sEx11151. | Generated based on WC-CalTech XREF data|"Made_by: Baillie Lab"|"No longer available from the CGC catalogue 24/04/2020"|"sEx11151 [rCes F56E10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)." | WBGene00001067(dpy-5) | WBGene00001067(dpy-5) | WB-STRAIN:WBStrain00042260 | WormBase (WB) | WB | unknown | WB-STRAIN:BC11151 | 2026-08-08 10:16:34 | 0 | |||
|
BC13689 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00042271 | Caenorhabditis elegans | dpy-5(e907) I; sEx13689. | Generated based on CalTech XREF data|"Made_by: Baillie Lab"|"No longer available from the CGC catalogue 24/04/2020"|"sEx13689 [rCes F45G2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)." | WBGene00001067(dpy-5) | WBGene00001067(dpy-5) | WB-STRAIN:WBStrain00042271 | WormBase (WB) | WB | unknown | WB-STRAIN:BC13689 | 2026-08-08 10:16:35 | 0 | |||
|
BC14173 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00042273 | Caenorhabditis elegans | dpy-5(e907) I; sEx14173. | Generated based on CalTech XREF data|"No longer available from the CGC catalogue 24/04/2020"|"sEx14172[rCesK08F8.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Was previously called BC14172." | WBGene00001067(dpy-5) | WBGene00001067(dpy-5) | WB-STRAIN:WBStrain00042273 | WormBase (WB) | WB | available | WB-STRAIN:BC14173, CGC_BC14173 | 2026-08-08 10:16:35 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
