Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
PJ801 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030682 | Caenorhabditis elegans | jDf1/mnC1 [dpy-10(e128) unc-52(e444)] II. | Heterozygotes are Unc (Paralyzed adult) and segregate more Uncs, DpyUncs and dead eggs. Growth slow. Pick Unc to maintain. Crossover suppressed.|"Mutagen:Gamma Rays" | WBGene00001072(dpy-10)|WBGene00006787(unc-52) | WBGene00001072(dpy-10), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00030682 | WormBase (WB) | WB | available | PMID:3396869 | WB-STRAIN:PJ801, CGC_PJ801 | 2026-09-12 11:16:14 | 0 | ||
|
PJ104 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030680 | Caenorhabditis elegans | cad-1(j1) unc-52(e669) II. | Unc-progressive paralysis. Reduced cathepsin. | WBGene00000278(cad-1)|WBGene00006787(unc-52) | WBGene00000278(cad-1), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00030680 | WormBase (WB) | WB | available | PMID:3396869 | WB-STRAIN:PJ104, CGC_PJ104 | 2026-09-12 11:16:14 | 0 | ||
|
PD7271 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030603 | Caenorhabditis elegans | pha-1(e2123) III; ccEx7271. | ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Sporadic germ cell expression can be observed when maintained at 25C. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00030603 | WormBase (WB) | WB | available | WB-STRAIN:PD7271, CGC_PD7271 | 2026-09-12 11:16:13 | 0 | |||
|
PD7963 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030604 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00001948(hlh-1) | WBGene00001948(hlh-1) | WB-STRAIN:WBStrain00030604 | WormBase (WB) | WB | unknown | WB-STRAIN:PD7963 | 2026-09-12 11:16:13 | 0 | |||
|
PD7244 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030602 | Caenorhabditis elegans | let-856(cc529) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals. | WBGene00001072(dpy-10)|WBGene00002955(let-856)|WBGene00006744(unc-4)|WBGene00006787(unc-52) | WBGene00001072(dpy-10), WBGene00002955(let-856), WBGene00006744(unc-4), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00030602 | WormBase (WB) | WB | available | PMID:9136012 | WB-STRAIN:PD7244, CGC_PD7244 | 2026-09-12 11:16:13 | 0 | ||
|
PJ1015 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030687 | Caenorhabditis elegans | unc-29(e1072) I; ccIs55 V. | ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc. | WBGene00006765(unc-29)|WBGene00006789(unc-54) | WBGene00006765(unc-29), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00030687 | WormBase (WB) | WB | available | PMID:10806111 | WB-STRAIN:PJ1015, CGC_PJ1015 | 2026-09-12 11:16:14 | 0 | ||
|
PJ1017 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030688 | Caenorhabditis elegans | egl-43(n1079) II; ccIs55 V. | ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 25C. | WBGene00001207(egl-43) | WBGene00001207(egl-43) | WB-STRAIN:WBStrain00030688 | WormBase (WB) | WB | available | WB-STRAIN:PJ1017, CGC_PJ1017 | 2026-09-12 11:16:14 | 0 | |||
|
PD8120 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030609 | Caenorhabditis elegans | smg-1(cc546) I. | Made_by: Getz and Fire|"Reference WBPaper00058995 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype smg-1(cc546)"|"Supplementary_genotype smg-1(cc546) I"|"Temperature sensitive. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]"|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data." | WBGene00004879(smg-1) | WBGene00004879(smg-1) | WB-STRAIN:WBStrain00030609 | WormBase (WB) | WB | available | PMID:31882874 PMID:32302543 PMID:37728486 PMID:37936921 |
WB-STRAIN:PD8120, CGC_PD8120 | 2026-09-12 11:16:13 | 1 | ||
|
PD8119 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030608 | Caenorhabditis elegans | smg-1(cc545) I. | Made_by: Getz and Fire|"Temperature sensitive. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).]" | WBGene00004879(smg-1) | WBGene00004879(smg-1) | WB-STRAIN:WBStrain00030608 | WormBase (WB) | WB | available | WB-STRAIN:PD8119, CGC_PD8119 | 2026-09-12 11:16:13 | 0 | |||
|
PF207 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030651 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00030651 | WormBase (WB) | WB | unknown | WB-STRAIN:PF207 | 2026-09-12 11:16:14 | 0 | |||||
|
PF214 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030658 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00030658 | WormBase (WB) | WB | unknown | WB-STRAIN:PF214 | 2026-09-12 11:16:14 | 0 | |||||
|
PF212 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030656 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00030656 | WormBase (WB) | WB | unknown | WB-STRAIN:PF212 | 2026-09-12 11:16:14 | 0 | |||||
|
PF209 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030653 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00030653 | WormBase (WB) | WB | unknown | WB-STRAIN:PF209 | 2026-09-12 11:16:14 | 0 | |||||
|
PF217 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030661 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00030661 | WormBase (WB) | WB | unknown | WB-STRAIN:PF217 | 2026-09-12 11:16:14 | 0 | |||||
|
PFR39 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030669 | Caenorhabditis elegans | hpl-2(tm1489) unc-49(e407) III. | Made_by: C. Coustham|"Unc. Thermosensitive. Sterile at 25C." | WBGene00001996(hpl-2)|WBGene00006784(unc-49) | WBGene00001996(hpl-2), WBGene00006784(unc-49) | WB-STRAIN:WBStrain00030669 | WormBase (WB) | WB | available | WB-STRAIN:PFR39, CGC_PFR39 | 2026-09-12 11:16:14 | 0 | |||
|
PJ1062 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030701 | Caenorhabditis elegans | let-60(n1046) IV; ccIs55 V. | ccIs55 [unc-54::lacZ + sup-7(st5)] V. | WBGene00002335(let-60)|WBGene00006789(unc-54) | WBGene00002335(let-60), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00030701 | WormBase (WB) | WB | available | WB-STRAIN:PJ1062, CGC_PJ1062 | 2026-09-12 11:16:15 | 0 | |||
|
PF224 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030668 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00030668 | WormBase (WB) | WB | unknown | WB-STRAIN:PF224 | 2026-09-12 11:16:14 | 0 | |||||
|
PJ1055 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030700 | Caenorhabditis elegans | cha-1(p1182) IV; unc-68(r1162) ccIs55 V. | ccIs55 [unc-54::lacZ + sup-7(st5)] V. Slow movement at 25C; might not curl like cha-1 typically does. Very slow movemenet at 20C. unc-68 channel null.|"ccIs55 [unc-54::lacZ + sup-7(st5)] V. Slow movement at 25C; might not curl like cha-1 typically does. Very slow movement at 20C. unc-68 channel null."|"Made_by: K. Poydence" | WBGene00000481(cha-1)|WBGene00006801(unc-68) | WBGene00000481(cha-1), WBGene00006801(unc-68) | WB-STRAIN:WBStrain00030700 | WormBase (WB) | WB | available | WB-STRAIN:PJ1055, CGC_PJ1055 | 2026-09-12 11:16:15 | 0 | |||
|
PF222 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030666 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00030666 | WormBase (WB) | WB | unknown | WB-STRAIN:PF222 | 2026-09-12 11:16:14 | 0 | |||||
|
PF219 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030663 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00030663 | WormBase (WB) | WB | unknown | WB-STRAIN:PF219 | 2026-09-12 11:16:14 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
