Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
pezo-1(av149) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047943 | Caenorhabditis elegans | pezo-1(av149) IV. | av149 is a CRISPR/Cas9 engineered deletion in the C-terminal region of pezo-1 removing the last seven exons (2733) and introns. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.|"Batch Strain object requested via get_NS_ids.pl"|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain." | WBGene00007505(pezo-1) | WBGene00007505(pezo-1) | WB-STRAIN:WBStrain00047943 | WormBase (WB) | WB | available | PMID:32490809 | CGC_AG416 | WormBase | 2026-10-10 11:01:38 | 0 | ||
|
unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V). Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048564 | Caenorhabditis elegans | unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V). | CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain." | WBGene00003161(mdf-2)|WBGene00006843(unc-119) | WBGene00003161(mdf-2), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00048564 | WormBase (WB) | WB | available | PMID:31588029 | CGC_OD2174 | WormBase | 2026-10-10 11:01:47 | 0 | ||
|
cyb-3(lt110) V/nT1 [qIs51] (IV;V). Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048566 | Caenorhabditis elegans | cyb-3(lt110) V/nT1 [qIs51] (IV;V). | CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain." | WBGene00000868(cyb-3) | WBGene00000868(cyb-3) | WB-STRAIN:WBStrain00048566 | WormBase (WB) | WB | available | PMID:31588029 | CGC_OD3737 | WormBase | 2026-10-10 11:01:47 | 0 | ||
|
che-7(ot866[che-7::TagRFP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048568 | Caenorhabditis elegans | che-7(ot866[che-7::TagRFP]) V. | Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"tagRFP inserted into endogenous che-7 locus." | WBGene00000488(che-7) | WBGene00000488(che-7) | WB-STRAIN:WBStrain00048568 | WormBase (WB) | WB | available | PMID:32356725 | CGC_OH16372 | WormBase | 2026-10-10 11:01:47 | 0 | ||
|
RW12085 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00048836 | Caenorhabditis elegans | EMPTY | Modern strain accessioned as a batch with get_NS_ids.pl | WB-STRAIN:WBStrain00048836 | WormBase (WB) | WB | available | CGC_RW12085 | WormBase | 2026-10-10 11:01:51 | 0 | |||||
|
IGX2 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00046991 | Serratia marcescens | Serratia marcescens | Db11. Tetracyclin, streptomycin and kanamycin resistant. A spontaneous mutant resistant to streptomycin isolated from Db10. See Flyg, Kenne K, Boman HG: Insect pathogenic properties of Serratia marcescens: phage-resistant mutants with a decreased resistance to Cecropia immunity and a decreased virulence to Drosophila. J. Gen. Microbiol. 1980; 120: 173-181.|"No longer available from the CGC catalogue 24/04/2020"|"Non-elegans Strain" | WB-STRAIN:WBStrain00046991 | WormBase (WB) | WB | available | WB-STRAIN:IGX2, CGC_IGX2 | WormBase | 2026-10-10 11:01:24 | 0 | |||||
|
IGX1 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00046990 | Serratia marcescens | Serratia marcescens. | Db10. Tetracyclin resistant. A non-pigmented strain of Serratia marcescens isolated from moribund Drosophila flies. See Flyg, Kenne K, Boman HG: Insect pathogenic properties of Serratia marcescens: phage-resistant mutants with a decreased resistance to Cecropia immunity and a decreased virulence to Drosophila. J. Gen. Microbiol. 1980; 120: 173-181.|"Non-elegans Strain" | WB-STRAIN:WBStrain00046990 | WormBase (WB) | WB | available | WB-STRAIN:IGX1, CGC_IGX1 | WormBase | 2026-10-10 11:01:24 | 0 | |||||
|
ltSi1 II; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00044397 | Caenorhabditis elegans | ltSi1 II; unc-119(ed3) III. | Generated based on CalTech XREF data|"ltSi1 [knl-1p::knl-1(re-encoded)::RFP + Cbr-unc-119(+)] II. KNL-1::RFP has been re-coded to be knl-1(RNAi) resistant. Reference: Espeut J, et al. Cell Rep. 2015 Jul 7;12(1):58-65. doi: 10.1016/j.celrep.2015.05.039. PMID: 26119738"|"Made_by: Arshad Desai lab" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00044397 | WormBase (WB) | WB | available | CGC_OD334 | WormBase | 2026-10-10 11:00:48 | 0 | |||
|
syIs503. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00044793 | Caenorhabditis elegans | syIs503. | Generated based on CalTech XREF data|"Made_by: Mengyi Cao"|"syIs503 [15xUAS::Chrimson::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder (NEB)]. Red light-activated channelrhodopsin cGAL effector. Reference: Cao M, et al. Application of the red-shifted channel rhodopsin Chrimson for the Caenorhabditis elegans cGAL bipartite system. MicroPubl Biol. 2018 Aug 22;2018:10.17912/2JGW-FJ52. doi: 10.17912/2JGW-FJ52. PMID: 32550400." | WB-STRAIN:WBStrain00044793 | WormBase (WB) | WB | available | CGC_PS8023 | WormBase | 2026-10-10 11:00:54 | 0 | |||||
|
ustSi25 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00045475 | Caenorhabditis elegans | ustSi25 II. | Generated based on CalTech XREF data|"ustSi25 [wago-4p::3xFlag::GFP::wago-4::wago-4 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Xu F, et al. Cell rep. 2018 May 22;23(8):2482-2494. doi: 10.1016/j.celrep.2018.04.072. PMID: 29791857." | WB-STRAIN:WBStrain00045475 | WormBase (WB) | WB | available | CGC_SHG487 | WormBase | 2026-10-10 11:01:03 | 0 | |||||
|
BK205 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00042363 | Caenorhabditis elegans | EMPTY | Generated based on CalTech XREF data | WB-STRAIN:WBStrain00042363 | WormBase (WB) | WB | available | CGC_BK205 | WormBase | 2026-10-10 11:00:21 | 0 | |||||
|
BK210 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00042365 | Caenorhabditis elegans | EMPTY | Generated based on CalTech XREF data | WB-STRAIN:WBStrain00042365 | WormBase (WB) | WB | available | CGC_BK210 | WormBase | 2026-10-10 11:00:21 | 0 | |||||
|
BK204 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00042362 | Caenorhabditis elegans | EMPTY | Generated based on CalTech XREF data | WB-STRAIN:WBStrain00042362 | WormBase (WB) | WB | available | CGC_BK204 | WormBase | 2026-10-10 11:00:21 | 0 | |||||
|
BK220 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00042367 | Caenorhabditis elegans | EMPTY | Generated based on CalTech XREF data | WB-STRAIN:WBStrain00042367 | WormBase (WB) | WB | available | CGC_BK220 | WormBase | 2026-10-10 11:00:21 | 0 | |||||
|
CS215 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00042531 | Caenorhabditis elegans | sma-3(wk30) III; him-5(e1490) V; qcEx55. | Generated based on CalTech XREF data|"No longer available from the CGC catalogue 24/04/2020"|"qcEx55 [vha-7p::GFP::sma-3 + rol-6(su1006)]. Rollers. Pick rollers to maintain. Array rescues body size phenotype. Reference: Wang J, Tokarz R, Savage-Dunn C. Development. 2002 Nov;129(21):4989-98." | WBGene00001864(him-5)|WBGene00004857(sma-3) | WBGene00001864(him-5), WBGene00004857(sma-3) | WB-STRAIN:WBStrain00042531 | WormBase (WB) | WB | available | WB-STRAIN:CS215, CGC_CS215 | WormBase | 2026-10-10 11:00:23 | 2 | |||
|
ufIs126 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00043502 | Caenorhabditis elegans | ufIs126 V. | Generated based on CalTech XREF data|"Supplementary_genotype ufIs126"|"ufIs126 [flp-13p::acr-12::GFP + lgc-11::mCherry] V. ACR-12::GFP expression labels postsynaptic iAChRs in DD motor neurons. References: Philbrook A, et al. eLife. 2018 Jul 24;7:e35692. doi: 10.7554/eLife.35692. PMID: 30039797. Oliver D, et al. PLoS Genet. 2022 Jan 28;18(1):e1010016. doi: 10.1371/journal.pgen.1010016. PMID: 35089924. Alexander K, et al. bioRxiv 2022.10.21.512874; doi: https:" | WB-STRAIN:WBStrain00043502 | WormBase (WB) | WB | available | PMID:37980357 | CGC_IZ1458 | WormBase | 2026-10-10 11:00:36 | 0 | ||||
|
unc-119(ed3) III; kpIs100. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00043478 | Caenorhabditis elegans | unc-119(ed3) III; kpIs100. | Generated based on CalTech XREF data|"kpIs100 [pie-1p::Ub(G76V)::GFP::H2B::drp-1 3' UTR + unc-119(+)]. [NOTE: (4/4/2025): Strain segregates Dpy, Rol, and non-Rol, possibly due to a background dpy-10 mutation; bothexpress GFP as expected. It was recommended that non-Rollers be picked when maintaining the strain.] Expresses Ubiquitin::GFP fusion protein in the germ line. The last amino acid of ubiquitin is mutated to valine (G76V), which prevents the cleavage of ubiquitin from GFP by the deubiqutinating enzymes and renders the GFP constitutively targeted for degradation by the proteasome. The strain can be used to assay proteasome activity in the germ line. Reference: Kumar GA & Subramaniam K. Development. 2018 Mar 29;145(7):dev163949. PMID: 29540500" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00043478 | WormBase (WB) | WB | available | CGC_IT1187 | WormBase | 2026-10-10 11:00:36 | 0 | |||
|
DR787 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006319 | Caenorhabditis elegans | dpy-13(e184) ama-1(m118) let-276(m240)/nT1 IV; +/nT1 V. | Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, DpyLet and dead eggs. Lethal early larval. Maintain by picking semi-Dpy.|"Made_by: Bullerjahn A" | WBGene00000123(ama-1)|WBGene00001074(dpy-13)|WBGene00002505(let-276) | WBGene00000123(ama-1), WBGene00001074(dpy-13), WBGene00002505(let-276) | WB-STRAIN:WBStrain00006319 | WormBase (WB) | WB | available | PMID:8608933 | WB-STRAIN:DR787, CGC_DR787 | WormBase | 2026-10-10 10:51:19 | 0 | ||
|
DR786 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006318 | Caenorhabditis elegans | ama-1(m322) IV. | Made_by: Bullerjahn A|"WT strain. Resistant to _-amanitin." | WBGene00000123(ama-1) | WBGene00000123(ama-1) | WB-STRAIN:WBStrain00006318 | WormBase (WB) | WB | available | PMID:8608933 | WB-STRAIN:DR786, CGC_DR786 | WormBase | 2026-10-10 10:51:19 | 0 | ||
|
DR731 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006314 | Caenorhabditis elegans | dpy-13(e184) ama-1(m118m251) IV. | Dpy. Sensitive to alpha-amanitin. Temperature sensitive, maintain at 15C. Fertile at 20C. Emb at restrictive temperature (25C). Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416. | WBGene00000123(ama-1)|WBGene00001074(dpy-13) | WBGene00000123(ama-1), WBGene00001074(dpy-13) | WB-STRAIN:WBStrain00006314 | WormBase (WB) | WB | available | WB-STRAIN:DR731, CGC_DR731 | WormBase | 2026-10-10 10:51:19 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
