Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00026920

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003014(lin-28)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003014(lin-28)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) lin-28(n719) I.
Alternate IDs: WB-STRAIN:MT2007, CGC_MT2007
Notes: Dpy. Egl.

Proper citation: RRID:WB-STRAIN:WBStrain00026920 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00027263

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00006753(unc-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00006753(unc-14)
Availability: available
Source References: PMID:8756352
Synonyms: dpy-5(e61) nDf43/dpy-14(e188) unc-14(e57) I.
Alternate IDs: WB-STRAIN:MT6356, CGC_MT6356
Notes: Heterozygotes are WT and segregate WT, DpyUncs and animals which arrest as L1 or L2 larvae (nDf43) homozygotes.

Proper citation: RRID:WB-STRAIN:WBStrain00027263 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00027389

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003387(mod-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003387(mod-5)
Availability: available
Source References: EMPTY
Synonyms: mod-5(n3314) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:MT11190, CGC_MT11190
Notes: Dpy. Serotonin hypersensitive. 5-HT hypersensitivity phenotype. Hyperslowing in locomotion assay.

Proper citation: RRID:WB-STRAIN:WBStrain00027389 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00027334

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003186(mek-2)|WBGene00006320(sup-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003186(mek-2), WBGene00006320(sup-11)
Availability: available
Source References: PMID:7729691
Synonyms: mek-2(n2678)/sup-11(n403) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:MT8667, CGC_MT8667
Notes: Heterozygotes are WT and segregate WT, Sterile Vuls and scrawny Dpys. n2678 is a suppressor of let-60(n1046) Muv. n2678 animals are Vul and recessive sterile. n2678 is a strong allele, probably null. See also WBPaper00002150.

Proper citation: RRID:WB-STRAIN:WBStrain00027334 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00027345

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003036(lin-53)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003036(lin-53)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) lin-53(n833) I.
Alternate IDs: WB-STRAIN:MT8840, CGC_MT8840
Notes: Dpy. n833 is a synthetic Muv with lin-15A(n767).

Proper citation: RRID:WB-STRAIN:WBStrain00027345 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00062742

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00005077(src-1)|WBGene00006753(unc-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00005077(src-1), WBGene00006753(unc-14)
Availability: unknown
Source References: EMPTY
Synonyms: src-1(syb7248)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II.
Notes: juIs76 [unc-25p::GFP + lin-15(+)] II. D381A substitution mutation generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), embryonic lethality (syb7248 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00062742 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00062924

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-5::mNG(syb3312) I.
Notes: Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous dpy-5 locus."

Proper citation: RRID:WB-STRAIN:WBStrain00062924 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00062917

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004479(rps-10)|WBGene00006753(unc-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004479(rps-10), WBGene00006753(unc-14)
Availability: unknown
Source References: EMPTY
Synonyms: rps-10(cc2557)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I.
Notes: Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus cc2557 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc2557 is an engineered mutation creating an early stop (T8*). Presumptive rps-10 null. Heterozygous rps-10(cc2557)/tmC20 animals are delayed in development. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.|"Made_by: Elif Sarinay Cenik & Agustian Surya"

Proper citation: RRID:WB-STRAIN:WBStrain00062917 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034653

Source Database: WormBase (WB)
Affected Genes: WBGene00000431(ceh-6)|WBGene00001067(dpy-5)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00000431(ceh-6), WBGene00001067(dpy-5), WBGene00006765(unc-29)
Availability: available
Source References: WBPaper00014592(PMID:EMPTY)
Synonyms: ceh-6(mg60)/dpy-5(e61) unc-29(e1072) I.
Alternate IDs: WB-STRAIN:TB1, CGC_TB1
Notes: ceh-6(mg60) is lethal. Maintain by picking WT and check that it throws 1/4 Dpys. mg60 is a 1.3 kb deletion that removes part of the conserved POU-specific domain. PCR with primers PCR6-5 GAA-TTC-ATG-AAA-TCG-GAG-GCG-T (->) and PCR6-3 GTG-AGA-AGT-GAA-GAG-GAT-TGT-A (<-) yields a band of about 1.6 kb instead of 280 bp as in N2. Backcrossed more than 10 times; in addition, the left arm of LG I was recombined with lin-28 to remove the mutator locus.|"Made_by: Tom Burglin"

Proper citation: RRID:WB-STRAIN:WBStrain00034653 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037917

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00011971(lron-9)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00011971(lron-9)
Availability: available
Source References: EMPTY
Synonyms: lron-9(gk5062[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I.
Alternate IDs: WB-STRAIN:VC4100, CGC_VC4100
Notes: Homozygous lethal deletion balanced by tmC18. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes and Dpy non-GFP (tmC18). Deletion of 2039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTGTCGTATTTTTGTTACAGTACCTACG ; Right flanking sequence: GGTGGTTGGAAGATTCCATCAGCACGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous lethal deletion balanced by tmC18. Heterozygotes are WT with pharyngeal GFP, and segregate GFP heterozygotes, GFP gk5062 homozygotes (arrest stage undetermined), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+ to maintain. Deletion of 2039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTGTCGTATTTTTGTTACAGTACCTACG ; Right flanking sequence: GGTGGTTGGAAGATTCCATCAGCACGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037917 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00040930

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006806(unc-74)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006806(unc-74)
Availability: available
Source References: EMPTY
Synonyms: unc-74(x19) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:ZZ1012, CGC_ZZ1012
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00040930 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00055439

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004389(rnp-6)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004389(rnp-6), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: rnp-6(ve790[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC20 [dpy-5(tm9709)] I.
Notes: Early larval arrest. Deletion of 7256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain KR16. unc-11 dpy-5 homozygotes no longer carrying the duplication were outcrossed 5 times to N2 to remove dpy-5; however, unc-11 may still be in the background. rnp-6 deletion was balanced over tmC20 [dpy-5(tm9709)] by crossing with strain FX30235. Balanced heterozygotes are semi-Dpy GFP+, and segregate semi-Dpy GFP+, early larval lethal GFP+ (ve790 homozygotes), and non-GFP dpy-5 animals (tmC20 homozygotes). Maintain by picking semi-dpy GFP+. Left flanking Sequence: attaaaaacatggaggaattcgagaataca ; Right flanking sequence: GCCTGTTTTCGATGTCTGCCGAGTTTTCTT. sgRNA #4: TGGAAATACTGTCAAAGCGG; sgRNA #2: AGACATCGAAAACAGGCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055439 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054650

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00009163(drsh-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00009163(drsh-1)
Availability: unknown
Source References: EMPTY
Synonyms: drsh-1(viz43)/tmC18[dpy-5(tmIs1200[myo-2p::mVenus])] I.
Notes: Made_by: J. H. Seemann|"[D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010."

Proper citation: RRID:WB-STRAIN:WBStrain00054650 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00052037

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004268(rab-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004268(rab-5)
Availability: unknown
Source References: EMPTY
Synonyms: rab-5(udn11)/tmC18 [dpy-5(tmIs1200)] I.
Notes: Made_by: UDN Screening Center|"rab-5 [D135D]. Silent BstAPI site added in D135D allele for ease of genotyping. Balancer marked with myo-2p::Venus. Reference: Huang et al. 2022. PMID: 35121658"

Proper citation: RRID:WB-STRAIN:WBStrain00052037 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00052054

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004268(rab-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004268(rab-5)
Availability: unknown
Source References: EMPTY
Synonyms: rab-5(udn47)/tmC18 [dpy-5(tmIs1200)] I.
Notes: Made_by: UDN Screening Center|"rab-5 [A29A]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29A] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn47 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [A29A] homozygotes from taking over the population and losing the balancer! Silent DdeI site added in A29A allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658"

Proper citation: RRID:WB-STRAIN:WBStrain00052054 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00052050

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004268(rab-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004268(rab-5)
Availability: unknown
Source References: EMPTY
Synonyms: rab-5(udn64)/tmC18 [dpy-5(tmIs1236)] I; udnSi38 II.
Notes: Made_by: UDN Screening Center|"udnSi38 [rab5p::rab-5] II. Maintain at 20 degrees. rab-5 [D135N] variant edit #2 with a single copy of wild-type rab-5 integrated into chromosome II at ttTi5605 site (II: 0.77). Homozygous lethal rab-5 [D135N] mutation balanced by tmC18. Balancer marked with myo-2p::mCherry. Heterozygotes are WT with pharyngeal mCherry fluorescence, and segregate mCherry + heterozygotes, non-mCherry rab-5 [D135N] homozygotes (L1 lethal), and Dpy mCherry+ tmC18 homozygotes. Pick fertile wild-type mCherry+ to maintain. [D135N]/ [D135N]; udnSi38/udnSi38 double homozygotes are lethal. Reference: Huang et al. 2022. PMID: 35121658"

Proper citation: RRID:WB-STRAIN:WBStrain00052050 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00052049

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004268(rab-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004268(rab-5)
Availability: unknown
Source References: EMPTY
Synonyms: rab-5(udn49)/tmC18 [dpy-5(tmIs1200)] I.
Notes: Homozygous lethal rab-5 [A29P] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29P] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent DdeI site added in A29P for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658|"Made_by: UDN Screening Center"

Proper citation: RRID:WB-STRAIN:WBStrain00052049 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00052038

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004268(rab-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004268(rab-5)
Availability: unknown
Source References: EMPTY
Synonyms: rab-5(udn17)/tmC18 [dpy-5(tmIs1200)] I.
Notes: Homozygous lethal rab-5 [Q78R] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78R] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent KpnI site added in Q78R for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658|"Made_by: UDN Screening Center"

Proper citation: RRID:WB-STRAIN:WBStrain00052038 Copy   

•   Source: Integrated Animals