Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
syIs615. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055247 | Caenorhabditis elegans | syIs615. | Made_by: Jun Young Oh/Shahla Gharib|"syIs615 [15xUAS::lmp-1::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Lysosomal associated membrane protein cGAL effector." | WB-STRAIN:WBStrain00055247 | WormBase (WB) | WB | unknown | PMID:38096407 | 2026-08-29 09:28:53 | 0 | |||||
|
syIs589. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055241 | Caenorhabditis elegans | syIs589. | Made_by: Jun Young Oh/Shahla Gharib|"syIs589 [15xUAS::wrmScarlet::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] mScarlet cGAL effector." | WB-STRAIN:WBStrain00055241 | WormBase (WB) | WB | unknown | PMID:38096407 | 2026-08-29 09:28:53 | 0 | |||||
|
syIs534; syIs300 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055240 | Caenorhabditis elegans | syIs534; syIs300 | Made_by: Chun-Hao Chen/Jun Young Oh|"syIs534 [flp-20p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + inx-11p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for gland cell. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055240 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:52 | 0 | ||||||
|
syIs591; syIs300. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055242 | Caenorhabditis elegans | syIs591; syIs300. | Made_by: Jun Young Oh/Cynthia Chen|"syIs591 [srh-142p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ADF neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055242 | WormBase (WB) | WB | unknown | PMID:38096407 | 2026-08-29 09:28:52 | 0 | |||||
|
syIs627; syIs300. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055249 | Caenorhabditis elegans | syIs627; syIs300. | Made_by: Jun Young Oh/Shahla Gharib|"syIs627 [str-2p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055249 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:52 | 0 | ||||||
|
frpr-8(sy1362) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055248 | Caenorhabditis elegans | frpr-8(sy1362) X. | Made_by: Heenam Park & Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-8. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTTATTTCGCTTCTTAATAATTCTACACTGGTCA right flanking sequence: CTACGGATCAGCCAGGTTTTTCTGGAAGTACAAAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAATTCTACACTGGTCACTA Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00018728(frpr-8) | WBGene00018728(frpr-8) | WB-STRAIN:WBStrain00055248 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:52 | 0 | ||||
|
frpr-14(sy1300) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055238 | Caenorhabditis elegans | frpr-14(sy1300) II. | Made_by: Heenam Park & Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-14. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCGATATTTTGCAATTCCTGTTTGGGATCCACAG right flanking sequence: ATCCAGAATATTTGgtgagtttaggcttaggcttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACCAAATATTCTGGATCTG Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00019496(frpr-14) | WBGene00019496(frpr-14) | WB-STRAIN:WBStrain00055238 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:52 | 0 | ||||
|
syIs587. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055237 | Caenorhabditis elegans | syIs587. | Made_by: Jun Young Oh/Shahla Gharib|"syIs587 [15xUAS::GCaMP7f::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. In vivo calcium indicator cGAL effector." | WB-STRAIN:WBStrain00055237 | WormBase (WB) | WB | unknown | PMID:38096407 | 2026-08-29 09:28:51 | 0 | |||||
|
daf-2 (e1370) III; glo-1(sy1306) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055239 | Caenorhabditis elegans | daf-2 (e1370) III; glo-1(sy1306) X. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of glo-1 in daf-2 (e1370) background. left flanking sequence: GATAAAATTTCCTACAAAGTGTTGGTAATTGGTGA; right flanking sequence: TCCAGGTGTCGGTAAAACATCTATTATTCGTCG. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGTTGGTAATTGGTGATCC Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00000898(daf-2)|WBGene00011083(glo-1) | WBGene00000898(daf-2), WBGene00011083(glo-1) | WB-STRAIN:WBStrain00055239 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:51 | 0 | ||||
|
syIs815; syIs337. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055339 | Caenorhabditis elegans | syIs815; syIs337. | Made_by: Mark Zhang/Stephanie Nava|"syIs815 [nlp-76p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector." | WB-STRAIN:WBStrain00055339 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:54 | 0 | ||||||
|
F33E11.3(sy2024) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055399 | Caenorhabditis elegans | F33E11.3(sy2024) V. | Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F33E11.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATGTTCGATATCAGCGATTGGCTCAGGAGTATA. Right flanking sequence: CGAAGgtgcggacgagaaaattttttttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTGGCTCAGGAGTATACGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616." | WBGene00018011(F33E11.3) | WBGene00018011(F33E11.3) | WB-STRAIN:WBStrain00055399 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:55 | 0 | ||||
|
F22G12.4(sy2022) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055398 | Caenorhabditis elegans | F22G12.4(sy2022) I. | Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F22G12.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: caccaaaacccaaccaatttccagAGAACCTTTCGG. Right flanking sequence: CAATGGATTTCCTGCTCGGCAACGGAGCCGATGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCCAGAGAACCTTTCGGCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616." | WBGene00009064(F22G12.4) | WBGene00009064(F22G12.4) | WB-STRAIN:WBStrain00055398 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:55 | 0 | ||||
|
+/nT1[umnIs49] IV; Y61A9LA.10(ve782[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055431 | Caenorhabditis elegans | +/nT1[umnIs49] IV; Y61A9LA.10(ve782[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 8730 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve782 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctTCAGGAGCTGCTCGCCGATGAGCCAAGA ; Right flanking sequence: cacggcgtgcgcgtcagtgtcacgaaacgc. sgRNA #1: GCAAAACTTCGAAAGGCTCT; sgRNA #2: aaattggttgctgacgcgca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055431 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:56 | 0 | ||||
|
F21G4.6(sy2013) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055397 | Caenorhabditis elegans | F21G4.6(sy2013) X. | Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F21G4.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATAACGGATGAATTAAGTACAAATGTATCGTTG. Right flanking sequence: GACAGGGAATTAAACCTTTTGAAATCGGCACAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTACAAATGTATCGTTGGAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616." | WBGene00009027(htt-1) | WBGene00009027(htt-1) | WB-STRAIN:WBStrain00055397 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:56 | 0 | ||||
|
pdi-3(ve781[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055430 | Caenorhabditis elegans | pdi-3(ve781[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 4472 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagtcgaagctgcaaacaataaataaataa ; Right flanking sequence: gggaacaccgacaaaaagttaaaaactaag. sgRNA #1: attacaaaagggaaacaacg; sgRNA #2: ttagagggcgagagattatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00003964(pdi-3)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00003964(pdi-3), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055430 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:57 | 0 | ||||
|
sfxn-1.4(sy2011) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055396 | Caenorhabditis elegans | sfxn-1.4(sy2011) II. | Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of sfxn-1.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTCCGCCGATTCTTGCTCGTCTCGTTCCATTT. Right flanking sequence: GCTGCTATTGCATTCGCCAATGCAATTAATATTCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCGAATGCAATAGCAGCAAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616." | WBGene00008137(sfxn-1.4) | WBGene00008137(sfxn-1.4) | WB-STRAIN:WBStrain00055396 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:55 | 0 | ||||
|
C23G10.7(ve787[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055436 | Caenorhabditis elegans | C23G10.7(ve787[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. | Homozygous viable. Deletion of 3575 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tccttgtatcgtccatttgaatgtcatcca ; Right flanking sequence: cagtgaaaaattaagcattagagcggtcaa. sgRNA #1: agtgaattttgtggcggctt; sgRNA #2: atcgtctcaaagctatgcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055436 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:57 | 0 | ||||
|
H40L08.3(ve786[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055435 | Caenorhabditis elegans | H40L08.3(ve786[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 6197 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGTTTTGAGATTTAGCAAGTAAATTGAGA ; Right flanking sequence: AGGATAATAATCGTTTTACCAGAGGCAAAG. sgRNA #1: ACGGAGTGTTCTAGGCGTCG; sgRNA #2: GTTTCACATCTCCGTTTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055435 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:56 | 0 | ||||
|
lim-8(sy1989) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055388 | Caenorhabditis elegans | lim-8(sy1989) III. | Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of lim-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ccacttttcagTCAAAAGAAGAAATCCTCCAAGT. Right flanking sequence: GAATTCGGCGTCTCGACCAGCACTGCCACGTCAGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTCGAGACGCCGAATTCACT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616." | WBGene00017904(lim-8) | WBGene00017904(lim-8) | WB-STRAIN:WBStrain00055388 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:56 | 0 | ||||
|
T01B7.5(ve771[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055421 | Caenorhabditis elegans | T01B7.5(ve771[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. | Made_by: RG KO Group|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous early larval arrest. Deletion of 3511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve771 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaattgctaatttttggatttcagatacta ; Right flanking sequence: gttgaatgtgtttttgtgtgcccggtcact. sgRNA #1: gaactATGTCATCAAGGAAG; sgRNA #2: cgactaaaagggcaaacgag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055421 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:57 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.