Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00040032
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001333(erm-1)|WBGene00006797(unc-63)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001333(erm-1), WBGene00006797(unc-63)
Availability: available
Source References: EMPTY
Synonyms: erm-1(tm677)/unc-63(x18) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:VJ311, CGC_VJ311
Notes: Heterozygotes are WT and segregate WT, DpyUncs, and erm-1 homozygotes which grow up to bagging adults with few progeny. Some of these hatch but die as L1s.|"Made_by: Mitani/Gobel/Barrett"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00040032 Copy
http://www.wormbase.org/db/get?name=WBStrain00037917
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00011971(lron-9)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00011971(lron-9)
Availability: available
Source References: EMPTY
Synonyms: lron-9(gk5062[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I.
Alternate IDs: WB-STRAIN:VC4100, CGC_VC4100
Notes: Homozygous lethal deletion balanced by tmC18. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes and Dpy non-GFP (tmC18). Deletion of 2039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTGTCGTATTTTTGTTACAGTACCTACG ; Right flanking sequence: GGTGGTTGGAAGATTCCATCAGCACGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous lethal deletion balanced by tmC18. Heterozygotes are WT with pharyngeal GFP, and segregate GFP heterozygotes, GFP gk5062 homozygotes (arrest stage undetermined), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+ to maintain. Deletion of 2039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTGTCGTATTTTTGTTACAGTACCTACG ; Right flanking sequence: GGTGGTTGGAAGATTCCATCAGCACGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037917 Copy
http://www.wormbase.org/db/get?name=WBStrain00026920
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003014(lin-28)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003014(lin-28)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) lin-28(n719) I.
Alternate IDs: WB-STRAIN:MT2007, CGC_MT2007
Notes: Dpy. Egl.
Proper citation: RRID:WB-STRAIN:WBStrain00026920 Copy
http://www.wormbase.org/db/get?name=WBStrain00023975
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:KR3831
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00023975 Copy
http://www.wormbase.org/db/get?name=WBStrain00023965
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006772(unc-36)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III.
Alternate IDs: WB-STRAIN:KR2467, CGC_KR2467
Notes: Heterozygotes are WT and segregate WT, DpyUnc, lethal hT2 homozygotes (arrest stage unknown) and dead eggs (aneuoloids). Maintain by picking WT. [March 1995: Apparently the lethal mutation is not in the balanced region. It occasionally crosses off and the strain starts giving Bli-4 hT2 homozygotes again. From Mark Edgley.] This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.|"Heterozygotes are WT and segregate WT, DpyUnc, lethal hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Maintain by picking WT. [March 1995: Apparently the lethal mutation is not in the balanced region. It occasionally crosses off and the strain starts giving Bli-4 hT2 homozygotes again. From Mark Edgley.] This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."|"Mutagen:Gamma Rays (hT2)"
Proper citation: RRID:WB-STRAIN:WBStrain00023965 Copy
http://www.wormbase.org/db/get?name=WBStrain00023919
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) unc-13(e450) I; hDp71 (I;f).
Alternate IDs: WB-STRAIN:KR1657, CGC_KR1657
Notes: Dpy-5 phenotype. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.|"Mutagen:gamma on KR1577"
Proper citation: RRID:WB-STRAIN:WBStrain00023919 Copy
http://www.wormbase.org/db/get?name=WBStrain00023918
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) unc-13(e450) I; hDp69 (I;f).
Alternate IDs: WB-STRAIN:KR1652, CGC_KR1652
Notes: Animals with the duplication are Dpy. Animals which have lost the duplication are DpyUnc. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.|"Mutagen:gamma on KR1577"
Proper citation: RRID:WB-STRAIN:WBStrain00023918 Copy
http://www.wormbase.org/db/get?name=WBStrain00023910
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006806(unc-74)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006806(unc-74)
Availability: available
Source References: PMID:2307351
Synonyms: unc-74(x19) dpy-5(e61) I; hDp77 (I;f).
Alternate IDs: WB-STRAIN:KR1626, CGC_KR1626
Notes: spontaneous from hDp3|"WT strain which segregates DpyUnc. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."
Proper citation: RRID:WB-STRAIN:WBStrain00023910 Copy
http://www.wormbase.org/db/get?name=WBStrain00023915
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) unc-13(e450) I; hDp56 (I;X;f).
Alternate IDs: WB-STRAIN:KR1649, CGC_KR1649
Notes: hDp56-bearing animals have Unc-13 phenotype, and segregate Unc-13 and Dpy-5 Unc-13 progeny. Pick Unc-13 and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.|"Made_by: McKim K"|"Mutagen:3000 R gamma"
Proper citation: RRID:WB-STRAIN:WBStrain00023915 Copy
http://www.wormbase.org/db/get?name=WBStrain00023916
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) unc-13(e450) I; hDp55 (I;f).
Alternate IDs: WB-STRAIN:KR1650, CGC_KR1650
Notes: Mutagen:Gamma Rays|"Unc-13 phenotype. Segregates Uncs and DpyUncs. The Uncs are slow growing; the DpyUncs will take over the population. Pick several Unc-13 animals and check for correct segregation of progeny to maintain. This duplication was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."
Proper citation: RRID:WB-STRAIN:WBStrain00023916 Copy
http://www.wormbase.org/db/get?name=WBStrain00023913
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) unc-13(e450) I; hDp34 (I;f).
Alternate IDs: WB-STRAIN:KR1633, CGC_KR1633
Notes: Made_by: McKim K|"Mutagen:3000 R gamma"|"Unc-13 phenotype. Segregates Unc-13 and Dpy-5 Unc-13. Pick Unc-13 and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."
Proper citation: RRID:WB-STRAIN:WBStrain00023913 Copy
http://www.wormbase.org/db/get?name=WBStrain00023908
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:9230900
Synonyms: dpy-5(e61) unc-13(e450) I; hDp33 (I;f).
Alternate IDs: WB-STRAIN:KR1621, CGC_KR1621
Notes: Mutagen:Gamma Rays|"Unc-13 phenotype. Segregates Uncs and DpyUncs. The Unc-13 animals are slow growing and DpyUncs will take over; pick several Unc-13 animals to a plate to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."
Proper citation: RRID:WB-STRAIN:WBStrain00023908 Copy
http://www.wormbase.org/db/get?name=WBStrain00023909
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) unc-13(e450) I; hDp37 (I;f).
Alternate IDs: WB-STRAIN:KR1624, CGC_KR1624
Notes: 1500 R gamma|"Made_by: McKim K"|"Mutagen:Gamma rays"|"Unc-13 phenotype. Segregates Unc-13 and Dpy-5 Unc-13 progeny. The Unc-13 animals are slow-growing, and DpyUncs will take over population. Pick several Unc-13 animals and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."
Proper citation: RRID:WB-STRAIN:WBStrain00023909 Copy
http://www.wormbase.org/db/get?name=WBStrain00023904
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00002729(let-539)|WBGene00003056(lon-2)|WBGene00006752(unc-13)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002729(let-539), WBGene00003056(lon-2), WBGene00006752(unc-13), WBGene00006765(unc-29)
Availability: available
Source References: PMID:9230900
Synonyms: dpy-5(e61) let-539(h938) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:KR1588, CGC_KR1588
Notes: Heterozygotes are WT and segregate WT, arrested DpyUncs, Lon males and large number of aneuploid progeny (arrested embyros or larvae). Note that unc-29 is outside the recombination-suppressed region of szT1 and may cross off resulting in Unc-29 progeny. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
Proper citation: RRID:WB-STRAIN:WBStrain00023904 Copy
http://www.wormbase.org/db/get?name=WBStrain00023905
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00002732(let-542)|WBGene00003056(lon-2)|WBGene00006752(unc-13)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002732(let-542), WBGene00003056(lon-2), WBGene00006752(unc-13), WBGene00006765(unc-29)
Availability: available
Source References: PMID:9230900
Synonyms: dpy-5(e61) let-542(h986) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:KR1594, CGC_KR1594
Notes: Heterozygotes are WT and segregate WT, arrested DpyUncs, Lon males and large number of aneuploid progeny (arrested embyros or larvae). Note that unc-29 is outside the recombination-suppressed region of szT1 and may cross off resulting in Unc-29 progeny. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
Proper citation: RRID:WB-STRAIN:WBStrain00023905 Copy
http://www.wormbase.org/db/get?name=WBStrain00023933
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2249758
Synonyms: hDf6 dpy-5(e61) unc-13(e450) I; hDp31 (I;f).
Alternate IDs: WB-STRAIN:KR1737, CGC_KR1737
Notes: Unc strain that throws Uncs and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
Proper citation: RRID:WB-STRAIN:WBStrain00023933 Copy
http://www.wormbase.org/db/get?name=WBStrain00023934
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
Source References: PMID:1603066
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp64 (I;f).
Alternate IDs: WB-STRAIN:KR1744, CGC_KR1744
Notes: This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
Proper citation: RRID:WB-STRAIN:WBStrain00023934 Copy
http://www.wormbase.org/db/get?name=WBStrain00023937
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
Source References: PMID:1603066
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp62 (I;f).
Alternate IDs: WB-STRAIN:KR1758, CGC_KR1758
Notes: This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
Proper citation: RRID:WB-STRAIN:WBStrain00023937 Copy
http://www.wormbase.org/db/get?name=WBStrain00023922
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00002700(let-508)|WBGene00003056(lon-2)|WBGene00006752(unc-13)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002700(let-508), WBGene00003056(lon-2), WBGene00006752(unc-13), WBGene00006765(unc-29)
Availability: available
Source References: PMID:2249758
Synonyms: let-508(h995) dpy-5(e61) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:KR1694, CGC_KR1694
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00023922 Copy
http://www.wormbase.org/db/get?name=WBStrain00023920
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) unc-13(e450) I; hDp61 (I;f).
Alternate IDs: WB-STRAIN:KR1673, CGC_KR1673
Notes: 1500 R gamma|"Made_by: McKim K"|"Mutagen:Gamma rays"|"Unc-13 phenotype. Segregates Unc-13 and Dpy-5 Unc-13. Pick Unc-13 and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."
Proper citation: RRID:WB-STRAIN:WBStrain00023920 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
