Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Database:WB (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Species

Sort Ascending

Sort Descending

 Synonyms

Sort Ascending

Sort Descending

 Notes
Phenotype

Sort Ascending

Sort Descending

 Affected Gene

Sort Ascending

Sort Descending

 Genomic Alteration

Sort Ascending

Sort Descending

 Catalog Number
Background

Sort Ascending

Sort Descending

 Database

Sort Ascending

Sort Descending

 Database Abbreviation

Sort Ascending

Sort Descending

 Availability

Sort Ascending

Sort Descending

 Source References

Sort Ascending

Sort Descending

 Alternate IDs
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
SP15
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034124 Caenorhabditis elegans unc-9(e101) unc-3(e151) X. Made_by: WBGene00006743(unc-3)|WBGene00006749(unc-9) WBGene00006743(unc-3), WBGene00006749(unc-9) WB-STRAIN:WBStrain00034124 WormBase (WB) WB available WB-STRAIN:SP15, CGC_SP15 2026-09-12 11:17:04 0
SP17
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034125 Caenorhabditis elegans unc-32(e189) dpy-1(e1) III. DpyUnc. WBGene00001063(dpy-1)|WBGene00006768(unc-32) WBGene00001063(dpy-1), WBGene00006768(unc-32) WB-STRAIN:WBStrain00034125 WormBase (WB) WB available WB-STRAIN:SP17, CGC_SP17 2026-09-12 11:17:05 0
SP24
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034126 Caenorhabditis elegans dpy-5(e61) unc-54(e190) I. DpyUnc. WBGene00001067(dpy-5)|WBGene00006789(unc-54) WBGene00001067(dpy-5), WBGene00006789(unc-54) WB-STRAIN:WBStrain00034126 WormBase (WB) WB available WB-STRAIN:SP24, CGC_SP24 2026-09-12 11:17:05 0
SP64
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034127 Caenorhabditis elegans unc-6(e78) dpy-6(e14) X. Dpy. Unc. WBGene00001068(dpy-6)|WBGene00006746(unc-6) WBGene00001068(dpy-6), WBGene00006746(unc-6) WB-STRAIN:WBStrain00034127 WormBase (WB) WB available WB-STRAIN:SP64, CGC_SP64 2026-09-12 11:17:05 0
SP250
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034175 Caenorhabditis elegans mnDp1 (X;V)/+ V; unc-3(e151) let-2(mn131) X. GROWTH SLOW LETHAL EMBRYONIC ts(TEMPERATURE-SENS) See also CGC 1806.|"Made_by: Meneely P" WBGene00002280(let-2)|WBGene00006743(unc-3) WBGene00002280(let-2), WBGene00006743(unc-3) WB-STRAIN:WBStrain00034175 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP250, CGC_SP250 2026-09-12 11:17:05 0
SP257
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034178 Caenorhabditis elegans mnDp1 (X;V)/+ V; unc-3(e151) let-37(mn138) X. LETHAL EARLY LARVAL. Maintain by picking WT.|"Made_by: Meneely P" WBGene00002312(let-37)|WBGene00006743(unc-3) WBGene00002312(let-37), WBGene00006743(unc-3) WB-STRAIN:WBStrain00034178 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP257, CGC_SP257 2026-09-12 11:17:05 0
SP259
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034179 Caenorhabditis elegans mnDp1 (X;V)/+ V; unc-3(e151) let-36(mn140) X. GROWTH SLOW. MALE-RESCUED. STERILE. Maintain by picking WT.|"Made_by: Meneely P" WBGene00002311(let-36)|WBGene00006743(unc-3) WBGene00002311(let-36), WBGene00006743(unc-3) WB-STRAIN:WBStrain00034179 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP259, CGC_SP259 2026-09-12 11:17:05 0
SP262
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034182 Caenorhabditis elegans mnDp1(X;V)/+ V; mnDf1 X. Made_by: Madl J|"WT Phenotype. Gives dead eggs." WB-STRAIN:WBStrain00034182 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP262, CGC_SP262 2026-09-12 11:17:05 0
SP265
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034183 Caenorhabditis elegans mnDp1(X;V)/+ V; mnDf4 X. Made_by: Meneely P|"WT PHENOTYPE." WB-STRAIN:WBStrain00034183 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP265, CGC_SP265 2026-09-12 11:17:05 0
SP266
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034184 Caenorhabditis elegans mnDp1(X;V)/+ V; mnDf5 X. Made_by: Meneely P|"WT PHENOTYPE. Should throw dead eggs." WB-STRAIN:WBStrain00034184 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP266, CGC_SP266 2026-09-12 11:17:05 0
SP268
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034186 Caenorhabditis elegans mnDp1(X;V)/+ V; mnDf7 X. Made_by: Meneely P|"WT PHENOTYPE. Should throw dead eggs." WB-STRAIN:WBStrain00034186 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP268, CGC_SP268 2026-09-12 11:17:05 0
SP269
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034187 Caenorhabditis elegans mnDp1(X;V)/+ V; mnDf8 X. Made_by: Meneely P|"WT PHENOTYPE." WB-STRAIN:WBStrain00034187 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP269, CGC_SP269 2026-09-12 11:17:05 0
SP270
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034188 Caenorhabditis elegans mnDp1(X;V)/+ V; mnDf9 X. Made_by: Meneely P|"WT PHENOTYPE." WB-STRAIN:WBStrain00034188 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP270, CGC_SP270 2026-09-12 11:17:05 0
SP271
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034189 Caenorhabditis elegans mnDp1(X;V)/+ V; mnDf10 X. Made_by: Meneely P|"WT PHENOTYPE" WB-STRAIN:WBStrain00034189 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP271, CGC_SP271 2026-09-12 11:17:05 0
SM190
 
Resource Report
Resource Website
1+ mentions 		RRID:WB-STRAIN:WBStrain00034104 Caenorhabditis elegans smg-1(cc546) I; pha-4(zu225) V. Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Made_by: Mary Ellen Domeier"|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data." WBGene00004013(pha-4)|WBGene00004879(smg-1) WBGene00004013(pha-4), WBGene00004879(smg-1) WB-STRAIN:WBStrain00034104 WormBase (WB) WB available PMID:32302543 WB-STRAIN:SM190, CGC_SM190 2026-09-12 11:17:04 1
SM202
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034105 Caenorhabditis elegans EMPTY EMPTY WBGene00003937(pax-1) WBGene00003937(pax-1) WB-STRAIN:WBStrain00034105 WormBase (WB) WB unknown WB-STRAIN:SM202 2026-09-12 11:17:04 0
SP272
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034190 Caenorhabditis elegans mnDp1(X;V)/+ V; mnDf11 X. Made_by: Meneely P|"WT PHENOTYPE" WB-STRAIN:WBStrain00034190 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP272, CGC_SP272 2026-09-12 11:17:05 0
SP274
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034192 Caenorhabditis elegans mnDp1(X;V)/+ V; mnDf15 X. Made_by: Meneely P|"WT PHENOTYPE" WB-STRAIN:WBStrain00034192 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP274, CGC_SP274 2026-09-12 11:17:05 0
SP275
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034193 Caenorhabditis elegans mnDp1(X;V)/+ V; mnDf17 X. Made_by: Meneely P|"WT PHENOTYPE" WB-STRAIN:WBStrain00034193 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP275, CGC_SP275 2026-09-12 11:17:05 0
SP276
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00034194 Caenorhabditis elegans mnDp1(X;V)/+ V; mnDf18 X. Made_by: Meneely P|"WT PHENOTYPE" WB-STRAIN:WBStrain00034194 WormBase (WB) WB available PMID:574105 WB-STRAIN:SP276, CGC_SP276 2026-09-12 11:17:05 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Test

Funding Opportunity: National NIH K12 DiabDocs Career Development Program

NIH Data Sharing and Reuse Seminar- Sex Differences in Acute Kidney Injury Risk and Outcomes: Insights from MIMIC-III and MIMIC-IV

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch