Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 110 showing 2181 ~ 2200 out of 2,338 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00002388

http://www.wormbase.org/db/get?name=WBStrain00002388

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sIs11074.
Alternate IDs: WB-STRAIN:BC12898, CGC_BC12898
Notes: sIs11074 [rCesC47B2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

Proper citation: RRID:WB-STRAIN:WBStrain00002388 Copy   

    • RRID:WB-STRAIN:WBStrain00002387

http://www.wormbase.org/db/get?name=WBStrain00002387

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sIs12060.
Alternate IDs: WB-STRAIN:BC12897, CGC_BC12897
Notes: Made_by: Baillie Lab|"sIs12060 [rCesZK430.2::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."

Proper citation: RRID:WB-STRAIN:WBStrain00002387 Copy   

    • RRID:WB-STRAIN:WBStrain00002317

http://www.wormbase.org/db/get?name=WBStrain00002317

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx12778.
Alternate IDs: WB-STRAIN:BC12778, CGC_BC12778
Notes: sEx12778 [rCesC26C6.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

Proper citation: RRID:WB-STRAIN:WBStrain00002317 Copy   

    • RRID:WB-STRAIN:WBStrain00002312

http://www.wormbase.org/db/get?name=WBStrain00002312

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx12772.
Alternate IDs: WB-STRAIN:BC12772, CGC_BC12772
Notes: sEx12772[rCesF08C6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

Proper citation: RRID:WB-STRAIN:WBStrain00002312 Copy   

    • RRID:WB-STRAIN:WBStrain00002315

http://www.wormbase.org/db/get?name=WBStrain00002315

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006970(zag-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006970(zag-1)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx12775.
Alternate IDs: WB-STRAIN:BC12775, CGC_BC12775
Notes: sEx12775 [rCesF28F9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

Proper citation: RRID:WB-STRAIN:WBStrain00002315 Copy   

    • RRID:WB-STRAIN:WBStrain00002310

http://www.wormbase.org/db/get?name=WBStrain00002310

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00017574(pxmp-4)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00017574(pxmp-4)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sIs11844.
Alternate IDs: WB-STRAIN:BC12766, CGC_BC12766
Notes: Made_by: Baillie Lab|"sIs11844 [rCes F18F11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."

Proper citation: RRID:WB-STRAIN:WBStrain00002310 Copy   

    • RRID:WB-STRAIN:WBStrain00002398

http://www.wormbase.org/db/get?name=WBStrain00002398

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00021506(Y41D4A.4)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00021506(Y41D4A.4)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sIs12716.
Alternate IDs: WB-STRAIN:BC12912, CGC_BC12912
Notes: Made_by: Baillie Lab|"sIs12716 [rCes Y41D4A.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."

Proper citation: RRID:WB-STRAIN:WBStrain00002398 Copy   

    • RRID:WB-STRAIN:WBStrain00002329

http://www.wormbase.org/db/get?name=WBStrain00002329

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00016682(C45G9.11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00016682(C45G9.11)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sIs12530.
Alternate IDs: WB-STRAIN:BC12795, CGC_BC12795
Notes: Made_by: Baillie Lab|"sIs12530 [rCes C45G9.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."

Proper citation: RRID:WB-STRAIN:WBStrain00002329 Copy   

    • RRID:WB-STRAIN:WBStrain00002324

http://www.wormbase.org/db/get?name=WBStrain00002324

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sIs11174.
Alternate IDs: WB-STRAIN:BC12789, CGC_BC12789
Notes: Made_by: Robert Hollebakken|"sIs11174 [rCesT01C8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."

Proper citation: RRID:WB-STRAIN:WBStrain00002324 Copy   

    • RRID:WB-STRAIN:WBStrain00002322

http://www.wormbase.org/db/get?name=WBStrain00002322

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sIs11990.
Alternate IDs: WB-STRAIN:BC12786, CGC_BC12786
Notes: Made_by: Simon Wong|"sIs11990 [rCesY106G6E.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."

Proper citation: RRID:WB-STRAIN:WBStrain00002322 Copy   

    • RRID:WB-STRAIN:WBStrain00002339

http://www.wormbase.org/db/get?name=WBStrain00002339

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00020097(larp-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00020097(larp-1)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx12810.
Alternate IDs: WB-STRAIN:BC12810, CGC_BC12810
Notes: sEx12810 [rCes R144.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

Proper citation: RRID:WB-STRAIN:WBStrain00002339 Copy   

    • RRID:WB-STRAIN:WBStrain00002335

http://www.wormbase.org/db/get?name=WBStrain00002335

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00012641(epg-6)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00012641(epg-6)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx12805.
Alternate IDs: WB-STRAIN:BC12805, CGC_BC12805
Notes: Made_by: Baillie Lab|"sEx12805 [rCes Y39A1A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."

Proper citation: RRID:WB-STRAIN:WBStrain00002335 Copy   

    • RRID:WB-STRAIN:WBStrain00002333

http://www.wormbase.org/db/get?name=WBStrain00002333

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00015125(hadb-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00015125(hadb-1)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx12801.
Alternate IDs: WB-STRAIN:BC12801, CGC_BC12801
Notes: Made_by: Baillie Lab|"sEx12801 [rCes B0303.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."

Proper citation: RRID:WB-STRAIN:WBStrain00002333 Copy   

    • RRID:WB-STRAIN:WBStrain00002332

http://www.wormbase.org/db/get?name=WBStrain00002332

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006410(nck-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006410(nck-1)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx12798.
Alternate IDs: WB-STRAIN:BC12798, CGC_BC12798
Notes: Made_by: Baillie Lab|"sEx12798 [rCes ZK470.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."

Proper citation: RRID:WB-STRAIN:WBStrain00002332 Copy   

    • RRID:WB-STRAIN:WBStrain00002351

http://www.wormbase.org/db/get?name=WBStrain00002351

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00013973(asp-18)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00013973(asp-18)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sIs11012.
Alternate IDs: WB-STRAIN:BC12835, CGC_BC12835
Notes: Made_by: Baillie Lab|"sIs11012 [rCes ZK384.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."

Proper citation: RRID:WB-STRAIN:WBStrain00002351 Copy   

    • RRID:WB-STRAIN:WBStrain00002350

http://www.wormbase.org/db/get?name=WBStrain00002350

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00016201(tdo-2)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00016201(tdo-2)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sIs11238.
Alternate IDs: WB-STRAIN:BC12834, CGC_BC12834
Notes: Made_by: Simon Wong|"sIs11238 [rCesC28H8.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."

Proper citation: RRID:WB-STRAIN:WBStrain00002350 Copy   

    • RRID:WB-STRAIN:WBStrain00002343

http://www.wormbase.org/db/get?name=WBStrain00002343

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004498(rps-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004498(rps-29)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx12819.
Alternate IDs: WB-STRAIN:BC12819
Notes: Made_by: Baillie Lab|"No longer available from the CGC"|"No longer available from the CGC catalogue 24/04/2020"|"sEx12819 [rCes B0412.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."

Proper citation: RRID:WB-STRAIN:WBStrain00002343 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055439

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004389(rnp-6)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004389(rnp-6), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: rnp-6(ve790[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC20 [dpy-5(tm9709)] I.
Notes: Early larval arrest. Deletion of 7256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain KR16. unc-11 dpy-5 homozygotes no longer carrying the duplication were outcrossed 5 times to N2 to remove dpy-5; however, unc-11 may still be in the background. rnp-6 deletion was balanced over tmC20 [dpy-5(tm9709)] by crossing with strain FX30235. Balanced heterozygotes are semi-Dpy GFP+, and segregate semi-Dpy GFP+, early larval lethal GFP+ (ve790 homozygotes), and non-GFP dpy-5 animals (tmC20 homozygotes). Maintain by picking semi-dpy GFP+. Left flanking Sequence: attaaaaacatggaggaattcgagaataca ; Right flanking sequence: GCCTGTTTTCGATGTCTGCCGAGTTTTCTT. sgRNA #4: TGGAAATACTGTCAAAGCGG; sgRNA #2: AGACATCGAAAACAGGCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055439 Copy   

http://www.wormbase.org/db/get?name=WBStrain00062742

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00005077(src-1)|WBGene00006753(unc-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00005077(src-1), WBGene00006753(unc-14)
Availability: unknown
Source References: EMPTY
Synonyms: src-1(syb7248)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II.
Notes: juIs76 [unc-25p::GFP + lin-15(+)] II. D381A substitution mutation generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), embryonic lethality (syb7248 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00062742 Copy   

    • RRID:WB-STRAIN:WBStrain00062924

http://www.wormbase.org/db/get?name=WBStrain00062924

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-5::mNG(syb3312) I.
Notes: Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous dpy-5 locus."

Proper citation: RRID:WB-STRAIN:WBStrain00062924 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Join Dr. Chen Li for a Knowledge Portal Network Webinar on the dkNET Computational Core on August 6

Join NIH ODSS Data Sharing and Reuse Seminar "PanKbase: An Open, FAIR Knowledge Base of the Human Pancreas to Accelerate Diabetes Research"

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch