Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
(SDxF344)F1xBN-Rbm20m1Mlgw Resource Report Resource Website |
RRID:RGD_7241597 | Rattus norvegicus | This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd. | 7241597 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-25) | 7241597 | 2026-08-01 12:40:34 | 0 | |||||
|
SS.LEW-(D10Chm10-D10Rat11)(D16Chm48-D16Chm60)/Ayd Resource Report Resource Website |
RRID:RGD_8551718 | Rattus norvegicus | A double congenic strain derived from the progenitor strain SS.LEW-(D10Chm10-D10Rat11)/Ayd and SS.LEW-(D16Chm48-D16Chm60)/Ayd | 8551718 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 8551718 | 2026-08-01 12:40:33 | 0 | |||||
|
SS.LEW-(D10Rat155-D10Chm171)/Ayd Resource Report Resource Website |
RRID:RGD_8657392 | Rattus norvegicus | A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd. | 8657392 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 8657392 | 2026-08-01 12:40:34 | 0 | |||||
|
SS.LEW-(D10Chm10-D10Rat11)(D10Chm246-D10Chm257)/Ayd Resource Report Resource Website |
RRID:RGD_8551714 | Rattus norvegicus | A double congenic strain derived from the progenitor strain SS.LEW-(D10Chm10-D10Rat11)/Ayd and SS.LEW-(D10Chm246-D10Chm257)/Ayd | 8551714 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 8551714 | 2026-08-01 12:40:33 | 0 | |||||
|
SS.MNS-(D2Chm214-D2Chm302)/Ayd Resource Report Resource Website |
RRID:RGD_8657399 | Rattus norvegicus | Congenic substrain created by backcrossing congenic strain MNS/N strain with Dahl Salt-sensitive (SS/Jr) strain, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. | 8657399 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 8657399 | 2026-08-01 12:40:34 | 0 | |||||
|
WDB-ROSA26em1(RT2)Nips Resource Report Resource Website |
RRID:RGD_8552371 | Rattus norvegicus | This strain was produced by knock-in in the rat ROSA26 locus using the construct 5' arm--tdTomato--IRES-Puro^r-pA--3' arm (11 kb) to the WDB/Nips strain. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN | 8552371 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 8552371 | 2026-08-01 12:40:34 | 0 | |||||
|
SS.LEW-(D5Mco42-D5Mco47)/1Mco Resource Report Resource Website |
RRID:RGD_7777180 | Rattus norvegicus | SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain | 7777180 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 7777180 | 2026-08-01 12:40:34 | 0 | |||||
|
CrlNarl:LE Resource Report Resource Website |
RRID:RGD_9587835 | Rattus norvegicus | Imported from Charles River in 1997, now maintained at National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan | 9587835 | outbred | Rat Genome Database (RGD) | RGD | Live Animals (as of 2018-03-28) | 9587835 | 2026-08-01 12:40:34 | 0 | |||||
|
SHRSP.SHR-(D1Rat93-D1Rat269)(D18Rat73-D18Rat11)/Izm Resource Report Resource Website |
RRID:RGD_7411703 | Rattus norvegicus | constructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segments National BioResource Project for the Rat in Japan | 7411703 | congenic | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 7411703 | 2026-08-01 12:40:34 | 0 | |||||
|
SS.LEW-(D3Rat2-D3Chm79)(D10Rat194-D10Chm243)/Ayd Resource Report Resource Website |
RRID:RGD_8551727 | Rattus norvegicus | A double congenic strain derived from the progenitor strain SS.LEW-(D3Rat2-D3Chm79)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd | 8551727 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 8551727 | 2026-08-01 12:40:33 | 0 | |||||
|
SS.LEW-(D3Rat52-D3Chm57),MNS-(D2Chm214-D2Chm302),LEW-(D10Rat194-D10Chm243)/Ayd Resource Report Resource Website |
RRID:RGD_8657402 | Rattus norvegicus | A triple congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Chm57)/Ayd, SS.MNS-(D2Chm214-D2Chm302)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd | 8657402 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 8657402 | 2026-08-01 12:40:34 | 0 | |||||
|
SS.LEW-(D17Chm131-D17Chm93)/Ayd Resource Report Resource Website |
RRID:RGD_7421621 | Rattus norvegicus | A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. | 7421621 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 7421621 | 2026-08-01 12:40:34 | 0 | |||||
|
SD-Tg(UBC-DsRedT3-emGFP)18Narl Resource Report Resource Website |
RRID:RGD_9587464 | Rattus norvegicus | This strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter. National Laboratory Animal Center, Taiwan | 9587464 | transgenic | Rat Genome Database (RGD) | RGD | Live Animals | 9587464 | 2026-08-01 12:40:34 | 0 | |||||
|
SD-Tg(UBC-cre/ERT2)7Narl Resource Report Resource Website |
RRID:RGD_9587466 | Rattus norvegicus | This strain was generated by microinjection of SD embyos with UBC-Cre/ERT2 transgene which is composed of Cre/ERT2 recombinase gene driven by human UBC promoter. National Laboratory Animal Center, Taiwan | 9587466 | transgenic | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2017-05-31) | 9587466 | 2026-08-01 12:40:34 | 0 | |||||
|
DA.PVG.1AV1-(D4Kini3-D4Rat177)/Kini Resource Report Resource Website |
RRID:RGD_7240521 | Rattus norvegicus | DA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic strain | 7240521 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 7240521 | 2026-08-01 12:40:34 | 0 | |||||
|
SHR/Utx Resource Report Resource Website |
RRID:RGD_8142385 | Rattus norvegicus | Animals transferred from Professor T. Suzuki, Kinki University School of Medicine, Kinki, Japan in 2002, descended from the original SHR sub-strains reported by Okamoto, 1974 | 8142385 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 8142385 | 2026-08-01 12:40:34 | 0 | |||||
|
DA.PVG.1AV1-(D4Kiru12-D4Kiru55)/Kiru Resource Report Resource Website |
RRID:RGD_7240514 | Rattus norvegicus | Congenic substrain derived by marker-assisted transfer of the desired region from DA.PVG.1AV1-(D4Kiru90-D4Kiru111)/Kiru onto the genetic background of DA/ZtmKini | 7240514 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 7240514 | 2026-08-01 12:40:34 | 0 | |||||
|
DA.PVG.1AV1-(D4Kiru90-D4Kiru111)/Kiru Resource Report Resource Website |
RRID:RGD_7240513 | Rattus norvegicus | congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini | 7240513 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 7240513 | 2026-08-01 12:40:33 | 0 | |||||
|
DA.PVG.1AV1-(D4Rat113-D4Kiru80)/Kiru Resource Report Resource Website |
RRID:RGD_7240512 | Rattus norvegicus | congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini | 7240512 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 7240512 | 2026-08-01 12:40:34 | 0 | |||||
|
LE-Pink1em1Sage-/- Resource Report Resource Website |
RRID:RGD_7241049 | Rattus norvegicus | ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offspring maintained as homozygous. This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC). inotiv | 7241049 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2024-11-26) | 7241049 | 2026-08-01 12:40:35 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
