Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC2211 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037170 | Caenorhabditis elegans | pqn-90(gk989) IV. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y73F8A.8. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 519 bp. Deletion left flank: AAGCTGGTGCAGATGGAAGTGTGCATTGTG. Deletion right flank: AAGATTGACACTCATTCATAGATGGAGCAA. Insertion Sequence: ATTGACACTCATTC." | WBGene00004170(pqn-90) | WBGene00004170(pqn-90) | WB-STRAIN:WBStrain00037170 | WormBase (WB) | WB | available | WB-STRAIN:VC2211, CGC_VC2211 | 2026-08-15 09:33:24 | 0 | |||
|
VC2218 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037176 | Caenorhabditis elegans | H19M22.3(ok2827)/sC1 [dpy-1(s2170)] III. | H19M22.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2827 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCCGTGACGCTTAAATGG. External right primer: ATAATTCAGTGCCCGAGAGC. Internal left primer: ATCTCCGACTACACCAGCGA. Internal right primer: AGCGTCCGTTGACTTGAGTT. Internal WT amplicon: 1135 bp. Deletion size: 538 bp. Deletion left flank: AGAAAAAAATCTAGCAGATTGCAAAATCTA. Deletion right flank: AGTGTGCAGTGAGCAGCTGCTGCGACAAGG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001063(dpy-1)|WBGene00019212(zmp-2) | WBGene00001063(dpy-1), WBGene00019212(zmp-2) | WB-STRAIN:WBStrain00037176 | WormBase (WB) | WB | available | WB-STRAIN:VC2218, CGC_VC2218 | 2026-08-15 09:33:24 | 0 | |||
|
VC2216 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037175 | Caenorhabditis elegans | K10D2.4(ok2759) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | K10D2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2759 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 658 bp. Deletion left flank: TTAAAATCTCAGCGGGAGTTTGATCAAATT. Deletion right flank: CATTGGGAAAGACGAACCGAATAATAGGTA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00019630(emb-1) | WBGene00000254(bli-4), WBGene00019630(emb-1) | WB-STRAIN:WBStrain00037175 | WormBase (WB) | WB | available | WB-STRAIN:VC2216, CGC_VC2216 | 2026-08-15 09:33:23 | 0 | |||
|
VC2228 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037184 | Caenorhabditis elegans | +/szT1 [lon-2(e678)] I; unc-97(ok2760)/szT1 X. | F14D12.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2760 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGCCAACTTTCAGTGGTT. External right primer: TGCGCTTTTTCAATTCTGTG. Internal left primer: CGACCACAACCATATCAACG. Internal right primer: CGTTTGCATGTTGGTTTCAT. Internal WT amplicon: 1239 bp. Deletion size: 516 bp. Deletion left flank: GGATGTTTCTGTTGTGAGATTTGCAATAAA. Deletion right flank: AACAGCACTTCCACAAGGTACTTGAAATAT. Insertion Sequence: AAGATTTGCAAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003056(lon-2)|WBGene00006826(unc-97) | WBGene00003056(lon-2), WBGene00006826(unc-97) | WB-STRAIN:WBStrain00037184 | WormBase (WB) | WB | available | WB-STRAIN:VC2228, CGC_VC2228 | 2026-08-15 09:33:23 | 0 | |||
|
VC2224 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037181 | Caenorhabditis elegans | F46F11.11&ubl-5(ok2820) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | F46F11.4, F46F11.11. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2820 homozygotes (viable but sickly). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAATCGGGACAGCTTCAGA. External right primer: CGCAAGTGTGAAACGCTATG. Internal left primer: AGCCATGATTTACAGGGTTCA. Internal right primer: TGCAGATTTTACCATACTTGCG. Internal WT amplicon: 3053 bp. Deletion size: 2291 bp. Deletion left flank: GTTACTGTACTTCTTTAAGGCGCACGCAAT. Deletion right flank: TCGACGCGCAAATGCAGACTTGCAATGTAA. Insertion Sequence: ACAATTGGAGATTTGAAATGTACGTAAAAACACACAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00006508(tns-1)|WBGene00006726(ubl-5) | WBGene00000254(bli-4), WBGene00006508(tns-1), WBGene00006726(ubl-5) | WB-STRAIN:WBStrain00037181 | WormBase (WB) | WB | available | WB-STRAIN:VC2224, CGC_VC2224 | 2026-08-15 09:33:23 | 0 | |||
|
VC2232 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037187 | Caenorhabditis elegans | his-70(ok2906) III. | E03A3.4. External left primer: TCCGTAAACTTTAGGCCACG. External right primer: TGTTCATTGAAATCACCGGA. Internal left primer: CCATCCACTGCAGACACAGT. Internal right primer: ACGTTTTTGAACGAAATGGG. Internal WT amplicon: 1317 bp. Deletion size: 370 bp. Deletion left flank: AAGAAACACGGGCATTGATCAAGATTTTAT. Deletion right flank: CGGGGAAAACCTTACGAGCAGCCTTCGTCG. Insertion Sequence: GATTT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001944(his-70) | WBGene00001944(his-70) | WB-STRAIN:WBStrain00037187 | WormBase (WB) | WB | available | WB-STRAIN:VC2232, CGC_VC2232 | 2026-08-15 09:33:23 | 0 | |||
|
VC2233 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037188 | Caenorhabditis elegans | Y38H6C.17(ok2930) V. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y38H6C.17. External left primer: CCGGTTGCTTACATGCCTAC. External right primer: GATTCGCCAATCTTCCAAAA. Internal left primer: AAGCAATACGTACCGGTCTACA. Internal right primer: AAAGTTTCCAAATTTTTCGGC. Internal WT amplicon: 1372 bp. Deletion size: 549 bp. Deletion left flank: ATTTATGACGTCATCAATACTGGAATATAA. Deletion right flank: ACAATTTTCCAGCAAAAACTTACACTGAAT." | WBGene00012629(slc-36.3) | WBGene00012629(slc-36.3) | WB-STRAIN:WBStrain00037188 | WormBase (WB) | WB | available | WB-STRAIN:VC2233, CGC_VC2233 | 2026-08-15 09:33:24 | 0 | |||
|
VC2229 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037185 | Caenorhabditis elegans | pfd-6(ok2785) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | F21C3.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2785 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: ATTTCAACGCTGCTGGAGAC. Internal left primer: ATGATGGCTGACTTTGAGCA. Internal right primer: TGCAAAGTTGGTTTTCACGA. Internal WT amplicon: 1193 bp. Deletion size: 286 bp. Deletion left flank: GATGTAATTAGCAATGACTTTTAACATAGA. Deletion right flank: TGTCTGAGATGCTGGCTTCCACTCGTTTGC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00009004(pfd-6) | WBGene00000254(bli-4), WBGene00009004(pfd-6) | WB-STRAIN:WBStrain00037185 | WormBase (WB) | WB | available | WB-STRAIN:VC2229, CGC_VC2229 | 2026-08-15 09:33:24 | 0 | |||
|
VC2186 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037149 | Caenorhabditis elegans | F41G3.10(ok2840)/mIn1 [mIs14 dpy-10(e128)] II. | F41G3.10. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2840 homozygotes (sickly Unc with small broods, often Dpy, various morphological defects; population can be maintained with difficulty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGATCATTCGAGTGGGAAGA. External right primer: GTCCACTAAACTTTGCCCCA. Internal left primer: AAATTGAGGATGGATGACGC. Internal right primer: AAACTCCCACGAAATCATGC. Internal WT amplicon: 1146 bp. Deletion size: 795 bp. Deletion left flank: TGTTGCAATAAGAACGCATAGCTGTACAAT. Deletion right flank: GTGTCTAACTGTGAACGAGTGGGCTTTTAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00018303(F41G3.10) | WBGene00001072(dpy-10), WBGene00018303(F41G3.10) | WB-STRAIN:WBStrain00037149 | WormBase (WB) | WB | available | WB-STRAIN:VC2186, CGC_VC2186 | 2026-08-15 09:33:24 | 0 | |||
|
VC2187 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037150 | Caenorhabditis elegans | ruvb-1(ok2847) V/nT1 [qIs51] (IV;V). | C27H6.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2847 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTCCACGTCCTCTACCTGA. External right primer: GTCAAGGGACTCGGAATTGA. Internal left primer: TCTTCCACACGTTTGAGCAC. Internal right primer: CTACAGGCTGCTGGATTCGT. Internal WT amplicon: 1221 bp. Deletion size: 780 bp. Deletion left flank: CTCGAGCGCGCGATAGAGATAGGTAAAACA. Deletion right flank: AGCAATCAATACAGCTCGTCCGGCCATACA. Insertion Sequence: ATCAATACAATCAATACAATCAATACATCAATACAATTAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007784(ruvb-1) | WBGene00007784(ruvb-1) | WB-STRAIN:WBStrain00037150 | WormBase (WB) | WB | available | WB-STRAIN:VC2187, CGC_VC2187 | 2026-08-15 09:33:22 | 0 | |||
|
VC2189 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037151 | Caenorhabditis elegans | K10D2.4&cid-1(ok2757) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | K10D2.4, K10D2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2757 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 713 bp. Deletion left flank: AGGCTGAAACAACCTTCATTTTACTTTTGC. Deletion right flank: AATGAAGTATATTAGGCCCTTCGTATTGCT. Insertion Sequence: AAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00019629(cid-1)|WBGene00019630(emb-1) | WBGene00000254(bli-4), WBGene00019629(cid-1), WBGene00019630(emb-1) | WB-STRAIN:WBStrain00037151 | WormBase (WB) | WB | available | WB-STRAIN:VC2189, CGC_VC2189 | 2026-08-15 09:33:22 | 0 | |||
|
VC2193 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037154 | Caenorhabditis elegans | ddl-1(ok2916) II. | F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGA TTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGT GTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC.|"F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGATTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGTGTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC."|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019125(ddl-1) | WBGene00019125(ddl-1) | WB-STRAIN:WBStrain00037154 | WormBase (WB) | WB | available | WB-STRAIN:VC2193, CGC_VC2193 | 2026-08-15 09:33:22 | 1 | |||
|
VC2194 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037155 | Caenorhabditis elegans | tub-2(ok2883) I. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y71G12A.3. External left primer: AGGCGACTTCTCTCCCTCTC. External right primer: TCATCATTATCGCCGATTCA. Internal left primer: GTGTGTGTGTGTGTGTGCGT. Internal right primer: TCCTTTCCACCAACGGATTA. Internal WT amplicon: 1267 bp. Deletion size: 861 bp. Deletion left flank: CAGATGACCTTACCCGTTATAACTTTAACC. Deletion right flank: TGGATAAGCTGCCGATTCCACTCAAGGAGA. Insertion Sequence: GATAAGC." | WBGene00022139(tub-2) | WBGene00022139(tub-2) | WB-STRAIN:WBStrain00037155 | WormBase (WB) | WB | available | WB-STRAIN:VC2194, CGC_VC2194 | 2026-08-15 09:33:24 | 0 | |||
|
VC2191 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037152 | Caenorhabditis elegans | Y54G11A.14(ok2884) II. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y54G11A.14. External left primer: TCAGACCGGTCATGGTACAC. External right primer: GGCGCTACTCCACTTTTGAA. Internal left primer: AAAACGCGAAACTATCGAAAA. Internal right primer: AAAAACTTACGCCATCGCC. Internal WT amplicon: 1138 bp. Deletion size: 686 bp. Deletion left flank: AAATTCAGGATCTTGGCTCCTGGAACGCAA. Deletion right flank: TTCTTGTGGCGCGAGTTGGATGCGGAGGAG. Insertion Sequence: A." | WBGene00013221(Y54G11A.14) | WBGene00013221(Y54G11A.14) | WB-STRAIN:WBStrain00037152 | WormBase (WB) | WB | available | WB-STRAIN:VC2191, CGC_VC2191 | 2026-08-15 09:33:24 | 0 | |||
|
VC2197 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037158 | Caenorhabditis elegans | sma-6(ok2894) II. | C32D5.2. External left primer: GCGTTGATCCAAAGGACAGT. External right primer: CAACTTTACGCTGCGATTGA. Internal left primer: TCGCAAAGCTCTGTATCGTG. Internal right primer: TCGGGGTTTTTGATCAACTC. Internal WT amplicon: 1159 bp. Deletion size: 304 bp. Deletion left flank: GTGGGAAGTTGCAATCAGGGTTGAGGTATG. Deletion right flank: GAAAAACGTCCCAGCACTTAATGAATTGAG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00004860(sma-6) | WBGene00004860(sma-6) | WB-STRAIN:WBStrain00037158 | WormBase (WB) | WB | available | WB-STRAIN:VC2197, CGC_VC2197 | 2026-08-15 09:33:24 | 1 | |||
|
VC2195 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037156 | Caenorhabditis elegans | C04G2.8(ok2887) IV. | C04G2.8. External left primer: TGTCCTGGGTAGGTTGGGTA. External right primer: ATCCCGAATCTGTCCAATCA. Internal left primer: GACCTTTTCACGAGGCAATC. Internal right primer: GGTCCTTCGACAACCATAGC. Internal WT amplicon: 1315 bp. Deletion size: 407 bp. Deletion left flank: ATTGAAAACGATTGGATAGAGAAGTCAGCG. Deletion right flank: AATAAGAGCGACTTCTGGAGCGGCTTCTGG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007307(spch-1) | WBGene00007307(spch-1) | WB-STRAIN:WBStrain00037156 | WormBase (WB) | WB | available | WB-STRAIN:VC2195, CGC_VC2195 | 2026-08-15 09:33:22 | 0 | |||
|
VC2196 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037157 | Caenorhabditis elegans | T12G3.1(ok2892) IV. | Made_by: Vancouver KO Group|"T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 795 bp. Deletion left flank: ATCAGTGAGCACTGAAACTGCCAAAAAAGC. Deletion right flank: AATGACCAAATTCGAAGAGAAAATGGATAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011737(sqst-1) | WBGene00011737(sqst-1) | WB-STRAIN:WBStrain00037157 | WormBase (WB) | WB | available | WB-STRAIN:VC2196, CGC_VC2196 | 2026-08-15 09:33:22 | 2 | |||
|
VC2202 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037162 | Caenorhabditis elegans | T05G5.8(ok2864) III. | Made_by: Vancouver KO Group|"T05G5.8. External left primer: AGAGCAGCATCACAAGTGGA. External right primer: CTGGAAAAGGGGGACAAAAT. Internal left primer: CAACATCCTGAACTAAAACCTGG. Internal right primer: TATGTGTAGAGTGGCGGCTG. Internal WT amplicon: 1123 bp. Deletion size: 373 bp. Deletion left flank: CCAGGAACTCATTTAAAGTTTTCTCTTGAG. Deletion right flank: TTGCTGTTCGATGAACCATTTTACAAAGTT. Insertion Sequence: TATTTATAAATACATCCAAGAAAGTATCAAAAACACTCCAAATAGCTTTTTCGAATGAA A."|"T05G5.8. External left primer: AGAGCAGCATCACAAGTGGA. External right primer: CTGGAAAAGGGGGACAAAAT. Internal left primer: CAACATCCTGAACTAAAACCTGG. Internal right primer: TATGTGTAGAGTGGCGGCTG. Internal WT amplicon: 1123 bp. Deletion size: 373 bp. Deletion left flank: CCAGGAACTCATTTAAAGTTTTCTCTTGAG. Deletion right flank: TTGCTGTTCGATGAACCATTTTACAAAGTT. Insertion Sequence: TATTTATAAATACATCCAAGAAAGTATCAAAAACACTCCAAATAGCTTTTTCGAATGAAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011502(vps-53) | WBGene00011502(vps-53) | WB-STRAIN:WBStrain00037162 | WormBase (WB) | WB | available | WB-STRAIN:VC2202, CGC_VC2202 | 2026-08-15 09:33:23 | 0 | |||
|
VC2205 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037165 | Caenorhabditis elegans | citk-2(ok2885) II. | F59A6.5. External left primer: CAACAACGAATCACACGAGG. External right primer: CCACTTTGCGTTGACTCTCA. Internal left primer: TGGACGCTGAGAACATCATC. Internal right primer: GATTCGAACCACCATCTCGT. Internal WT amplicon: 1323 bp. Deletion size: 693 bp. Deletion left flank: CAAGAACGACATGAAAGAGAACGATCGCAA. Deletion right flank: AACATTTGATTATGGCCGACCAACAGTGTT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019087(citk-2) | WBGene00019087(citk-2) | WB-STRAIN:WBStrain00037165 | WormBase (WB) | WB | available | WB-STRAIN:VC2205, CGC_VC2205 | 2026-08-15 09:33:23 | 0 | |||
|
VC2204 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037164 | Caenorhabditis elegans | unc-122(ok2882) I. | F11C3.2. External left primer: CCCATTCACATTTTCAGGCT. External right primer: TGCCGCACACCAATAATAAA. Internal left primer: CCGGCGAAATAGGAAATGTA. Internal right primer: ACTTCCTGCGGAAGAAACCT. Internal WT amplicon: 1145 bp. Deletion size: 327 bp. Deletion left flank: TGATCACAAAAATCAAGAACTCTCAGAGAA. Deletion right flank: GAAAAAATGGTTCCTGTGCCAGTAGTGGTT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006845(unc-122) | WBGene00006845(unc-122) | WB-STRAIN:WBStrain00037164 | WormBase (WB) | WB | available | WB-STRAIN:VC2204, CGC_VC2204 | 2026-08-15 09:33:24 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.