Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Species:caenorhabditis elegans (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

62,713 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
VC2211
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037170 Caenorhabditis elegans pqn-90(gk989) IV. Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y73F8A.8. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 519 bp. Deletion left flank: AAGCTGGTGCAGATGGAAGTGTGCATTGTG. Deletion right flank: AAGATTGACACTCATTCATAGATGGAGCAA. Insertion Sequence: ATTGACACTCATTC." WBGene00004170(pqn-90) WBGene00004170(pqn-90) WB-STRAIN:WBStrain00037170 WormBase (WB) WB available WB-STRAIN:VC2211, CGC_VC2211 2026-08-15 09:33:24 0
VC2218
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037176 Caenorhabditis elegans H19M22.3(ok2827)/sC1 [dpy-1(s2170)] III. H19M22.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2827 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCCGTGACGCTTAAATGG. External right primer: ATAATTCAGTGCCCGAGAGC. Internal left primer: ATCTCCGACTACACCAGCGA. Internal right primer: AGCGTCCGTTGACTTGAGTT. Internal WT amplicon: 1135 bp. Deletion size: 538 bp. Deletion left flank: AGAAAAAAATCTAGCAGATTGCAAAATCTA. Deletion right flank: AGTGTGCAGTGAGCAGCTGCTGCGACAAGG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001063(dpy-1)|WBGene00019212(zmp-2) WBGene00001063(dpy-1), WBGene00019212(zmp-2) WB-STRAIN:WBStrain00037176 WormBase (WB) WB available WB-STRAIN:VC2218, CGC_VC2218 2026-08-15 09:33:24 0
VC2216
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037175 Caenorhabditis elegans K10D2.4(ok2759) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). K10D2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2759 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 658 bp. Deletion left flank: TTAAAATCTCAGCGGGAGTTTGATCAAATT. Deletion right flank: CATTGGGAAAGACGAACCGAATAATAGGTA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000254(bli-4)|WBGene00019630(emb-1) WBGene00000254(bli-4), WBGene00019630(emb-1) WB-STRAIN:WBStrain00037175 WormBase (WB) WB available WB-STRAIN:VC2216, CGC_VC2216 2026-08-15 09:33:23 0
VC2228
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037184 Caenorhabditis elegans +/szT1 [lon-2(e678)] I; unc-97(ok2760)/szT1 X. F14D12.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2760 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGCCAACTTTCAGTGGTT. External right primer: TGCGCTTTTTCAATTCTGTG. Internal left primer: CGACCACAACCATATCAACG. Internal right primer: CGTTTGCATGTTGGTTTCAT. Internal WT amplicon: 1239 bp. Deletion size: 516 bp. Deletion left flank: GGATGTTTCTGTTGTGAGATTTGCAATAAA. Deletion right flank: AACAGCACTTCCACAAGGTACTTGAAATAT. Insertion Sequence: AAGATTTGCAAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00003056(lon-2)|WBGene00006826(unc-97) WBGene00003056(lon-2), WBGene00006826(unc-97) WB-STRAIN:WBStrain00037184 WormBase (WB) WB available WB-STRAIN:VC2228, CGC_VC2228 2026-08-15 09:33:23 0
VC2224
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037181 Caenorhabditis elegans F46F11.11&ubl-5(ok2820) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). F46F11.4, F46F11.11. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2820 homozygotes (viable but sickly). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAATCGGGACAGCTTCAGA. External right primer: CGCAAGTGTGAAACGCTATG. Internal left primer: AGCCATGATTTACAGGGTTCA. Internal right primer: TGCAGATTTTACCATACTTGCG. Internal WT amplicon: 3053 bp. Deletion size: 2291 bp. Deletion left flank: GTTACTGTACTTCTTTAAGGCGCACGCAAT. Deletion right flank: TCGACGCGCAAATGCAGACTTGCAATGTAA. Insertion Sequence: ACAATTGGAGATTTGAAATGTACGTAAAAACACACAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000254(bli-4)|WBGene00006508(tns-1)|WBGene00006726(ubl-5) WBGene00000254(bli-4), WBGene00006508(tns-1), WBGene00006726(ubl-5) WB-STRAIN:WBStrain00037181 WormBase (WB) WB available WB-STRAIN:VC2224, CGC_VC2224 2026-08-15 09:33:23 0
VC2232
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037187 Caenorhabditis elegans his-70(ok2906) III. E03A3.4. External left primer: TCCGTAAACTTTAGGCCACG. External right primer: TGTTCATTGAAATCACCGGA. Internal left primer: CCATCCACTGCAGACACAGT. Internal right primer: ACGTTTTTGAACGAAATGGG. Internal WT amplicon: 1317 bp. Deletion size: 370 bp. Deletion left flank: AAGAAACACGGGCATTGATCAAGATTTTAT. Deletion right flank: CGGGGAAAACCTTACGAGCAGCCTTCGTCG. Insertion Sequence: GATTT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001944(his-70) WBGene00001944(his-70) WB-STRAIN:WBStrain00037187 WormBase (WB) WB available WB-STRAIN:VC2232, CGC_VC2232 2026-08-15 09:33:23 0
VC2233
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037188 Caenorhabditis elegans Y38H6C.17(ok2930) V. Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y38H6C.17. External left primer: CCGGTTGCTTACATGCCTAC. External right primer: GATTCGCCAATCTTCCAAAA. Internal left primer: AAGCAATACGTACCGGTCTACA. Internal right primer: AAAGTTTCCAAATTTTTCGGC. Internal WT amplicon: 1372 bp. Deletion size: 549 bp. Deletion left flank: ATTTATGACGTCATCAATACTGGAATATAA. Deletion right flank: ACAATTTTCCAGCAAAAACTTACACTGAAT." WBGene00012629(slc-36.3) WBGene00012629(slc-36.3) WB-STRAIN:WBStrain00037188 WormBase (WB) WB available WB-STRAIN:VC2233, CGC_VC2233 2026-08-15 09:33:24 0
VC2229
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037185 Caenorhabditis elegans pfd-6(ok2785) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). F21C3.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2785 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: ATTTCAACGCTGCTGGAGAC. Internal left primer: ATGATGGCTGACTTTGAGCA. Internal right primer: TGCAAAGTTGGTTTTCACGA. Internal WT amplicon: 1193 bp. Deletion size: 286 bp. Deletion left flank: GATGTAATTAGCAATGACTTTTAACATAGA. Deletion right flank: TGTCTGAGATGCTGGCTTCCACTCGTTTGC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000254(bli-4)|WBGene00009004(pfd-6) WBGene00000254(bli-4), WBGene00009004(pfd-6) WB-STRAIN:WBStrain00037185 WormBase (WB) WB available WB-STRAIN:VC2229, CGC_VC2229 2026-08-15 09:33:24 0
VC2186
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037149 Caenorhabditis elegans F41G3.10(ok2840)/mIn1 [mIs14 dpy-10(e128)] II. F41G3.10. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2840 homozygotes (sickly Unc with small broods, often Dpy, various morphological defects; population can be maintained with difficulty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGATCATTCGAGTGGGAAGA. External right primer: GTCCACTAAACTTTGCCCCA. Internal left primer: AAATTGAGGATGGATGACGC. Internal right primer: AAACTCCCACGAAATCATGC. Internal WT amplicon: 1146 bp. Deletion size: 795 bp. Deletion left flank: TGTTGCAATAAGAACGCATAGCTGTACAAT. Deletion right flank: GTGTCTAACTGTGAACGAGTGGGCTTTTAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001072(dpy-10)|WBGene00018303(F41G3.10) WBGene00001072(dpy-10), WBGene00018303(F41G3.10) WB-STRAIN:WBStrain00037149 WormBase (WB) WB available WB-STRAIN:VC2186, CGC_VC2186 2026-08-15 09:33:24 0
VC2187
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037150 Caenorhabditis elegans ruvb-1(ok2847) V/nT1 [qIs51] (IV;V). C27H6.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2847 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTCCACGTCCTCTACCTGA. External right primer: GTCAAGGGACTCGGAATTGA. Internal left primer: TCTTCCACACGTTTGAGCAC. Internal right primer: CTACAGGCTGCTGGATTCGT. Internal WT amplicon: 1221 bp. Deletion size: 780 bp. Deletion left flank: CTCGAGCGCGCGATAGAGATAGGTAAAACA. Deletion right flank: AGCAATCAATACAGCTCGTCCGGCCATACA. Insertion Sequence: ATCAATACAATCAATACAATCAATACATCAATACAATTAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00007784(ruvb-1) WBGene00007784(ruvb-1) WB-STRAIN:WBStrain00037150 WormBase (WB) WB available WB-STRAIN:VC2187, CGC_VC2187 2026-08-15 09:33:22 0
VC2189
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037151 Caenorhabditis elegans K10D2.4&cid-1(ok2757) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). K10D2.4, K10D2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2757 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 713 bp. Deletion left flank: AGGCTGAAACAACCTTCATTTTACTTTTGC. Deletion right flank: AATGAAGTATATTAGGCCCTTCGTATTGCT. Insertion Sequence: AAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000254(bli-4)|WBGene00019629(cid-1)|WBGene00019630(emb-1) WBGene00000254(bli-4), WBGene00019629(cid-1), WBGene00019630(emb-1) WB-STRAIN:WBStrain00037151 WormBase (WB) WB available WB-STRAIN:VC2189, CGC_VC2189 2026-08-15 09:33:22 0
VC2193
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00037154 Caenorhabditis elegans ddl-1(ok2916) II. F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGA TTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGT GTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC.|"F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGATTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGTGTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC."|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00019125(ddl-1) WBGene00019125(ddl-1) WB-STRAIN:WBStrain00037154 WormBase (WB) WB available WB-STRAIN:VC2193, CGC_VC2193 2026-08-15 09:33:22 1
VC2194
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037155 Caenorhabditis elegans tub-2(ok2883) I. Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y71G12A.3. External left primer: AGGCGACTTCTCTCCCTCTC. External right primer: TCATCATTATCGCCGATTCA. Internal left primer: GTGTGTGTGTGTGTGTGCGT. Internal right primer: TCCTTTCCACCAACGGATTA. Internal WT amplicon: 1267 bp. Deletion size: 861 bp. Deletion left flank: CAGATGACCTTACCCGTTATAACTTTAACC. Deletion right flank: TGGATAAGCTGCCGATTCCACTCAAGGAGA. Insertion Sequence: GATAAGC." WBGene00022139(tub-2) WBGene00022139(tub-2) WB-STRAIN:WBStrain00037155 WormBase (WB) WB available WB-STRAIN:VC2194, CGC_VC2194 2026-08-15 09:33:24 0
VC2191
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037152 Caenorhabditis elegans Y54G11A.14(ok2884) II. Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y54G11A.14. External left primer: TCAGACCGGTCATGGTACAC. External right primer: GGCGCTACTCCACTTTTGAA. Internal left primer: AAAACGCGAAACTATCGAAAA. Internal right primer: AAAAACTTACGCCATCGCC. Internal WT amplicon: 1138 bp. Deletion size: 686 bp. Deletion left flank: AAATTCAGGATCTTGGCTCCTGGAACGCAA. Deletion right flank: TTCTTGTGGCGCGAGTTGGATGCGGAGGAG. Insertion Sequence: A." WBGene00013221(Y54G11A.14) WBGene00013221(Y54G11A.14) WB-STRAIN:WBStrain00037152 WormBase (WB) WB available WB-STRAIN:VC2191, CGC_VC2191 2026-08-15 09:33:24 0
VC2197
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00037158 Caenorhabditis elegans sma-6(ok2894) II. C32D5.2. External left primer: GCGTTGATCCAAAGGACAGT. External right primer: CAACTTTACGCTGCGATTGA. Internal left primer: TCGCAAAGCTCTGTATCGTG. Internal right primer: TCGGGGTTTTTGATCAACTC. Internal WT amplicon: 1159 bp. Deletion size: 304 bp. Deletion left flank: GTGGGAAGTTGCAATCAGGGTTGAGGTATG. Deletion right flank: GAAAAACGTCCCAGCACTTAATGAATTGAG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00004860(sma-6) WBGene00004860(sma-6) WB-STRAIN:WBStrain00037158 WormBase (WB) WB available WB-STRAIN:VC2197, CGC_VC2197 2026-08-15 09:33:24 1
VC2195
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037156 Caenorhabditis elegans C04G2.8(ok2887) IV. C04G2.8. External left primer: TGTCCTGGGTAGGTTGGGTA. External right primer: ATCCCGAATCTGTCCAATCA. Internal left primer: GACCTTTTCACGAGGCAATC. Internal right primer: GGTCCTTCGACAACCATAGC. Internal WT amplicon: 1315 bp. Deletion size: 407 bp. Deletion left flank: ATTGAAAACGATTGGATAGAGAAGTCAGCG. Deletion right flank: AATAAGAGCGACTTCTGGAGCGGCTTCTGG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00007307(spch-1) WBGene00007307(spch-1) WB-STRAIN:WBStrain00037156 WormBase (WB) WB available WB-STRAIN:VC2195, CGC_VC2195 2026-08-15 09:33:22 0
VC2196
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00037157 Caenorhabditis elegans T12G3.1(ok2892) IV. Made_by: Vancouver KO Group|"T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 795 bp. Deletion left flank: ATCAGTGAGCACTGAAACTGCCAAAAAAGC. Deletion right flank: AATGACCAAATTCGAAGAGAAAATGGATAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00011737(sqst-1) WBGene00011737(sqst-1) WB-STRAIN:WBStrain00037157 WormBase (WB) WB available WB-STRAIN:VC2196, CGC_VC2196 2026-08-15 09:33:22 2
VC2202
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037162 Caenorhabditis elegans T05G5.8(ok2864) III. Made_by: Vancouver KO Group|"T05G5.8. External left primer: AGAGCAGCATCACAAGTGGA. External right primer: CTGGAAAAGGGGGACAAAAT. Internal left primer: CAACATCCTGAACTAAAACCTGG. Internal right primer: TATGTGTAGAGTGGCGGCTG. Internal WT amplicon: 1123 bp. Deletion size: 373 bp. Deletion left flank: CCAGGAACTCATTTAAAGTTTTCTCTTGAG. Deletion right flank: TTGCTGTTCGATGAACCATTTTACAAAGTT. Insertion Sequence: TATTTATAAATACATCCAAGAAAGTATCAAAAACACTCCAAATAGCTTTTTCGAATGAA A."|"T05G5.8. External left primer: AGAGCAGCATCACAAGTGGA. External right primer: CTGGAAAAGGGGGACAAAAT. Internal left primer: CAACATCCTGAACTAAAACCTGG. Internal right primer: TATGTGTAGAGTGGCGGCTG. Internal WT amplicon: 1123 bp. Deletion size: 373 bp. Deletion left flank: CCAGGAACTCATTTAAAGTTTTCTCTTGAG. Deletion right flank: TTGCTGTTCGATGAACCATTTTACAAAGTT. Insertion Sequence: TATTTATAAATACATCCAAGAAAGTATCAAAAACACTCCAAATAGCTTTTTCGAATGAAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00011502(vps-53) WBGene00011502(vps-53) WB-STRAIN:WBStrain00037162 WormBase (WB) WB available WB-STRAIN:VC2202, CGC_VC2202 2026-08-15 09:33:23 0
VC2205
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037165 Caenorhabditis elegans citk-2(ok2885) II. F59A6.5. External left primer: CAACAACGAATCACACGAGG. External right primer: CCACTTTGCGTTGACTCTCA. Internal left primer: TGGACGCTGAGAACATCATC. Internal right primer: GATTCGAACCACCATCTCGT. Internal WT amplicon: 1323 bp. Deletion size: 693 bp. Deletion left flank: CAAGAACGACATGAAAGAGAACGATCGCAA. Deletion right flank: AACATTTGATTATGGCCGACCAACAGTGTT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00019087(citk-2) WBGene00019087(citk-2) WB-STRAIN:WBStrain00037165 WormBase (WB) WB available WB-STRAIN:VC2205, CGC_VC2205 2026-08-15 09:33:23 0
VC2204
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00037164 Caenorhabditis elegans unc-122(ok2882) I. F11C3.2. External left primer: CCCATTCACATTTTCAGGCT. External right primer: TGCCGCACACCAATAATAAA. Internal left primer: CCGGCGAAATAGGAAATGTA. Internal right primer: ACTTCCTGCGGAAGAAACCT. Internal WT amplicon: 1145 bp. Deletion size: 327 bp. Deletion left flank: TGATCACAAAAATCAAGAACTCTCAGAGAA. Deletion right flank: GAAAAAATGGTTCCTGTGCCAGTAGTGGTT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006845(unc-122) WBGene00006845(unc-122) WB-STRAIN:WBStrain00037164 WormBase (WB) WB available WB-STRAIN:VC2204, CGC_VC2204 2026-08-15 09:33:24 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.