Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241597
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-25)
Alternate IDs: 7241597
Notes: This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd.
Proper citation: RRID:RGD_7241597 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551718
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551718
Notes: A double congenic strain derived from the progenitor strain SS.LEW-(D10Chm10-D10Rat11)/Ayd and SS.LEW-(D16Chm48-D16Chm60)/Ayd
Proper citation: RRID:RGD_8551718 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8657392
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8657392
Notes: A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd.
Proper citation: RRID:RGD_8657392 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551714
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551714
Notes: A double congenic strain derived from the progenitor strain SS.LEW-(D10Chm10-D10Rat11)/Ayd and SS.LEW-(D10Chm246-D10Chm257)/Ayd
Proper citation: RRID:RGD_8551714 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8657399
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8657399
Notes: Congenic substrain created by backcrossing congenic strain MNS/N strain with Dahl Salt-sensitive (SS/Jr) strain, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.
Proper citation: RRID:RGD_8657399 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8552371
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 8552371
Notes: This strain was produced by knock-in in the rat ROSA26 locus using the construct 5' arm--tdTomato--IRES-Puro^r-pA--3' arm (11 kb) to the WDB/Nips strain. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN
Proper citation: RRID:RGD_8552371 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7777180
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7777180
Notes: SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain
Proper citation: RRID:RGD_7777180 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=9587835
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Live Animals (as of 2018-03-28)
Alternate IDs: 9587835
Notes: Imported from Charles River in 1997, now maintained at National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan
Proper citation: RRID:RGD_9587835 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7411703
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Cryopreserved Sperm
Alternate IDs: 7411703
Notes: constructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segments National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_7411703 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8551727
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8551727
Notes: A double congenic strain derived from the progenitor strain SS.LEW-(D3Rat2-D3Chm79)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd
Proper citation: RRID:RGD_8551727 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8657402
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 8657402
Notes: A triple congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Chm57)/Ayd, SS.MNS-(D2Chm214-D2Chm302)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd
Proper citation: RRID:RGD_8657402 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7421621
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7421621
Notes: A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.
Proper citation: RRID:RGD_7421621 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=9587464
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Live Animals
Alternate IDs: 9587464
Notes: This strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter. National Laboratory Animal Center, Taiwan
Proper citation: RRID:RGD_9587464 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=9587466
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Cryopreserved Embryo (as of 2017-05-31)
Alternate IDs: 9587466
Notes: This strain was generated by microinjection of SD embyos with UBC-Cre/ERT2 transgene which is composed of Cre/ERT2 recombinase gene driven by human UBC promoter. National Laboratory Animal Center, Taiwan
Proper citation: RRID:RGD_9587466 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7240521
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7240521
Notes: DA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic strain
Proper citation: RRID:RGD_7240521 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8142385
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 8142385
Notes: Animals transferred from Professor T. Suzuki, Kinki University School of Medicine, Kinki, Japan in 2002, descended from the original SHR sub-strains reported by Okamoto, 1974
Proper citation: RRID:RGD_8142385 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7240514
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7240514
Notes: Congenic substrain derived by marker-assisted transfer of the desired region from DA.PVG.1AV1-(D4Kiru90-D4Kiru111)/Kiru onto the genetic background of DA/ZtmKini
Proper citation: RRID:RGD_7240514 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7240513
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7240513
Notes: congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini
Proper citation: RRID:RGD_7240513 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7240512
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 7240512
Notes: congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini
Proper citation: RRID:RGD_7240512 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241049
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2024-11-26)
Alternate IDs: 7241049
Notes: ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offspring maintained as homozygous. This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC). inotiv
Proper citation: RRID:RGD_7241049 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.