Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00034053
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; gaEx225.
Alternate IDs: WB-STRAIN:SD1973, CGC_SD1973
Notes: gaEx225 [F13G11.3::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational F13G11.3::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.|"gaEx225 [F13G11.3::Dendra2 + Cbr-unc-119]. Pick non-Unc to maintain. Translational F13G11.3::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015."
Proper citation: RRID:WB-STRAIN:WBStrain00034053 Copy
http://www.wormbase.org/db/get?name=WBStrain00034011
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: ccIs4251 I; stIs10700.
Alternate IDs: WB-STRAIN:SD1649, CGC_SD1649
Notes: ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10700 [moe-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
Proper citation: RRID:WB-STRAIN:WBStrain00034011 Copy
http://www.wormbase.org/db/get?name=WBStrain00034015
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00001194(egl-27)
Genomic Alteration: WBGene00000898(daf-2), WBGene00001194(egl-27)
Availability: available
Source References: EMPTY
Synonyms: egl-27(we3) II; daf-2(e1370) III; muIs84.
Alternate IDs: WB-STRAIN:SD1743, CGC_SD1743
Notes: muIs84 [sod-3p::GFP + rol-6(su1006)]. Maintain at 20C. Embryonic lethal at 15C. Dauer formation at 25C. GFP should be visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.
Proper citation: RRID:WB-STRAIN:WBStrain00034015 Copy
http://www.wormbase.org/db/get?name=WBStrain00034017
Source Database: WormBase (WB)
Affected Genes: WBGene00001194(egl-27)
Genomic Alteration: WBGene00001194(egl-27)
Availability: available
Source References: EMPTY
Synonyms: egl-27(we3) II; wgIs177.
Alternate IDs: WB-STRAIN:SD1751, CGC_SD1751
Notes: wgIs177 [egl-27p::TY1::EGFP::3xFLAG + unc-119(+)]. Maintain at 20C or higher. Embryonic lethal at 15C. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.
Proper citation: RRID:WB-STRAIN:WBStrain00034017 Copy
http://www.wormbase.org/db/get?name=WBStrain00034020
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00000912(daf-16)
Genomic Alteration: WBGene00000898(daf-2), WBGene00000912(daf-16)
Availability: available
Source References: EMPTY
Synonyms: daf-16(mu86) I; daf-2(e1370) III; stIs10161.
Alternate IDs: WB-STRAIN:SD1778, CGC_SD1778
Notes: stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. mCherry visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.
Proper citation: RRID:WB-STRAIN:WBStrain00034020 Copy
http://www.wormbase.org/db/get?name=WBStrain00034029
Source Database: WormBase (WB)
Affected Genes: WBGene00006796(unc-62)
Genomic Alteration: WBGene00006796(unc-62)
Availability: available
Source References: EMPTY
Synonyms: unc-62(e644) V; wgIs600.
Alternate IDs: WB-STRAIN:SD1879, CGC_SD1879
Notes: wgIs600 [unc-62::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Derived from parental strains CB644 and SD1871.
Proper citation: RRID:WB-STRAIN:WBStrain00034029 Copy
http://www.wormbase.org/db/get?name=WBStrain00034022
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; gaEx231.
Alternate IDs: WB-STRAIN:SD1821, CGC_SD1821
Notes: gaEx231 [imp-2(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of IMP-2. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780.
Proper citation: RRID:WB-STRAIN:WBStrain00034022 Copy
http://www.wormbase.org/db/get?name=WBStrain00034023
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; gaEx229.
Alternate IDs: WB-STRAIN:SD1822, CGC_SD1822
Notes: gaEx229 [hsf-1(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of HSF-1. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780.
Proper citation: RRID:WB-STRAIN:WBStrain00034023 Copy
http://www.wormbase.org/db/get?name=WBStrain00034024
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; gaEx232.
Alternate IDs: WB-STRAIN:SD1823
Notes: gaEx207 [sod-3p::mCherry + aakg-2(sta2) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.|"gaEx232 [aakg-2(sta2)(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of activated AAKG-2. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780."
Proper citation: RRID:WB-STRAIN:WBStrain00034024 Copy
http://www.wormbase.org/db/get?name=WBStrain00034030
Source Database: WormBase (WB)
Affected Genes: WBGene00006796(unc-62)
Genomic Alteration: WBGene00006796(unc-62)
Availability: available
Source References: EMPTY
Synonyms: unc-62(s472) V; wgIs600.
Alternate IDs: WB-STRAIN:SD1880, CGC_SD1880
Notes: wgIs600 [unc-62::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Derived from parental strains BC1282 and SD1871.
Proper citation: RRID:WB-STRAIN:WBStrain00034030 Copy
http://www.wormbase.org/db/get?name=WBStrain00034119
Source Database: WormBase (WB)
Affected Genes: WBGene00006946(prx-10)
Genomic Alteration: WBGene00006946(prx-10)
Availability: available
Source References: EMPTY
Synonyms: prx-10(ssd68)
Alternate IDs: WB-STRAIN:SOZ259, CGC_SOZ259
Notes: Class I supersized lipid droplet mutant. Peroxisomal import defective. Homozygous viable. TGT-->TAT mutation, 5' flanking sequence acatttattctgttggacgt, 3' flanking sequence tattcaggagcacgcagtag .|"Made_by: Shaobing O. Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00034119 Copy
http://www.wormbase.org/db/get?name=WBStrain00034110
Source Database: WormBase (WB)
Affected Genes: WBGene00000256(bli-6)|WBGene00001079(dpy-20)|WBGene00006761(unc-24)|WBGene00006974(zen-4)
Genomic Alteration: WBGene00000256(bli-6), WBGene00001079(dpy-20), WBGene00006761(unc-24), WBGene00006974(zen-4)
Availability: available
Source References: EMPTY
Synonyms: zen-4(px47) dpy-20(e1282)/bli-6(sc16) unc-24(e138)
Alternate IDs: WB-STRAIN:SM1052, CGC_SM1052
Notes: Heterozygotes are WT and segregate WT, Bli Uncs, and dead embryos and L1s (with Pun phenotype).|"Made_by: M Portereiko"
Proper citation: RRID:WB-STRAIN:WBStrain00034110 Copy
http://www.wormbase.org/db/get?name=WBStrain00034199
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00002495(let-266)|WBGene00006744(unc-4)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00002495(let-266), WBGene00006744(unc-4), WBGene00006787(unc-52)
Availability: available
Source References: PMID:6500256
Synonyms: unc-4(e120) let-266(mn194)/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:SP286, CGC_SP286
Notes: Hets are WT and segregate WT, paralysed DpyUnc and lets.
Proper citation: RRID:WB-STRAIN:WBStrain00034199 Copy
http://www.wormbase.org/db/get?name=WBStrain00034113
Source Database: WormBase (WB)
Affected Genes: WBGene00000238(bar-1)|WBGene00003510(mxl-2)
Genomic Alteration: WBGene00000238(bar-1), WBGene00003510(mxl-2)
Availability: available
Source References: EMPTY
Synonyms: mxl-2(tm1516) III; bar-1(ga80) X.
Alternate IDs: WB-STRAIN:SM1508, CGC_SM1508
Notes: Most defects are similar to bar-1(ga80) single mutant animals [bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.] Increased severity of ray 1 displacement.
Proper citation: RRID:WB-STRAIN:WBStrain00034113 Copy
http://www.wormbase.org/db/get?name=WBStrain00034114
Source Database: WormBase (WB)
Affected Genes: WBGene00003976(pes-1)
Genomic Alteration: WBGene00003976(pes-1)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SM1535
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034114 Copy
http://www.wormbase.org/db/get?name=WBStrain00034116
Source Database: WormBase (WB)
Affected Genes: WBGene00000238(bar-1)|WBGene00001864(him-5)|WBGene00004047(plx-1)
Genomic Alteration: WBGene00000238(bar-1), WBGene00001864(him-5), WBGene00004047(plx-1)
Availability: available
Source References: EMPTY
Synonyms: plx-1(nc37) IV; him-5(e1490) V; bar-1(ga80) X.
Alternate IDs: WB-STRAIN:SM1585, CGC_SM1585
Notes: Hermaphrodites are sluggish and exhibit protruding vulva, ruptured vulva, or internally hatched progeny. Males move slower than WT and have disorganized tail rays.
Proper citation: RRID:WB-STRAIN:WBStrain00034116 Copy
http://www.wormbase.org/db/get?name=WBStrain00034120
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: cyp-37A1(ssd9) II.
Alternate IDs: WB-STRAIN:SOZ300, CGC_SOZ300
Notes: Made_by: Shaobing O. Zhang|"ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. cyp-37A1 previously known as drop-1."
Proper citation: RRID:WB-STRAIN:WBStrain00034120 Copy
http://www.wormbase.org/db/get?name=WBStrain00034121
Source Database: WormBase (WB)
Affected Genes: WBGene00008205(sams-1)
Genomic Alteration: WBGene00008205(sams-1)
Availability: unknown
Source References: EMPTY
Synonyms: sams-1(ssd206) X.
Alternate IDs: WB-STRAIN:SOZ471
Notes: no longer available from the CGC|"sams-1 (a.k.a.- drop-4) Class IV supersized lipid droplet mutant. GCT-->GTT mutation. 5' flanking sequence: agatccaaatgcaaaggttg. 3' flanking sequence: ttgcgagaccgtaacaaaaa References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846."
Proper citation: RRID:WB-STRAIN:WBStrain00034121 Copy
http://www.wormbase.org/db/get?name=WBStrain00034122
Source Database: WormBase (WB)
Affected Genes: WBGene00001262(emb-8)
Genomic Alteration: WBGene00001262(emb-8)
Availability: available
Source References: EMPTY
Synonyms: emb-8(ssd89) III.
Alternate IDs: WB-STRAIN:SOZ511, CGC_SOZ511
Notes: emb-8 (a.k.a.- drop-8) Class III supersized lipid droplet mutation. ssd89 is a GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.|"Made_by: Shaobing O. Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00034122 Copy
http://www.wormbase.org/db/get?name=WBStrain00034123
Source Database: WormBase (WB)
Affected Genes: WBGene00006743(unc-3)|WBGene00006747(unc-7)
Genomic Alteration: WBGene00006743(unc-3), WBGene00006747(unc-7)
Availability: available
Source References: EMPTY
Synonyms: unc-3(e151) unc-7(e139) X.
Alternate IDs: WB-STRAIN:SP14, CGC_SP14
Notes: Made_by:
Proper citation: RRID:WB-STRAIN:WBStrain00034123 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.