Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00023476
Source Database: WormBase (WB)
Affected Genes: WBGene00020506(dop-3)
Genomic Alteration: WBGene00020506(dop-3)
Availability: unknown
Source References: EMPTY
Synonyms: dop-3(tm1356) X.
Alternate IDs: WB-STRAIN:KDK1
Notes: Mutagen:UV/TMP|"T14E8.3. The original strain without backcrossing was provided by the National BioResource Project at Tokyo Women's Medical University School of Medicine (Japan)."
Proper citation: RRID:WB-STRAIN:WBStrain00023476 Copy
http://www.wormbase.org/db/get?name=WBStrain00023471
Source Database: WormBase (WB)
Affected Genes: WBGene00003295(mir-67)|WBGene00003311(mir-83)
Genomic Alteration: WBGene00003295(mir-67), WBGene00003311(mir-83)
Availability: available
Source References: EMPTY
Synonyms: mir-67(n4899) III; mir-83(n4638) IV.
Alternate IDs: WB-STRAIN:KB12, CGC_KB12
Notes: Combination mutant made with 6x outcrossed lines KB10 mir-67(n4899) and KB11 mir-83(n4638).|"Made_by: Bennett Lab"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00023471 Copy
http://www.wormbase.org/db/get?name=WBStrain00023469
Source Database: WormBase (WB)
Affected Genes: WBGene00003295(mir-67)
Genomic Alteration: WBGene00003295(mir-67)
Availability: available
Source References: EMPTY
Synonyms: mir-67(n4899) III.
Alternate IDs: WB-STRAIN:KB10, CGC_KB10
Notes: Made_by: Horvitz Lab|"MT15982 mir-67(n4899) was outcrossed 6x to produce this strain. Deletion breakpoints are:GGGTGCCTAATGCAAA / AGTACACATTTATGAAT...GCGAGTTTAAAGCAACG / AGTAGCAGAAGGACCA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00023469 Copy
http://www.wormbase.org/db/get?name=WBStrain00023463
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; seaEx13.
Alternate IDs: WB-STRAIN:KAE28, CGC_KAE28
Notes: seaEx13 [fmo-2p::GFP + unc-119(+)]. Pick non-Unc to maintain. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.
Proper citation: RRID:WB-STRAIN:WBStrain00023463 Copy
http://www.wormbase.org/db/get?name=WBStrain00023461
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: seaSi40 I; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:KAE10, CGC_KAE10
Notes: Made_by: Scott Leiser|"seaSi40 [(pCFJ448) (eft-3p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] I. Higher level of FMO-2 over-expression compared to KAE9. Improved healthspan, stress resistance and longevity. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8."|"seaSi40 [(pCFJ448) eft-3p::fmo-2 GFP + Cbr-unc-119(+)] I. Higher level of FMO-2 over-expression compared to KAE9. Improved healthspan, stress resistance and longevity. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8."
Proper citation: RRID:WB-STRAIN:WBStrain00023461 Copy
http://www.wormbase.org/db/get?name=WBStrain00023462
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: seaSi182 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:KAE12, CGC_KAE12
Notes: seaSi182 [(pCFJ150) (vha-6p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] II. Over-expression of FMO-2 in the intestine. Long-lived. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.|"seaSi182 [(pCFJ150) vha-6p::fmo-2::GFP + Cbr-unc-119(+)] II. Over-expression of FMO-2 in the intestine. Long-lived. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8."
Proper citation: RRID:WB-STRAIN:WBStrain00023462 Copy
http://www.wormbase.org/db/get?name=WBStrain00023500
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30254025
Synonyms: unc-116(ce815[LoxP1/unc-116/sup-1/LoxP2]);ceIs276[Punc17b::CRE]; ceIs269[Punc-129::TOMM-20-Venus; Punc-129::mCherry]
Alternate IDs: WB-STRAIN:KG4768
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00023500 Copy
http://www.wormbase.org/db/get?name=WBStrain00023468
Source Database: WormBase (WB)
Affected Genes: WBGene00002187(kgb-1)|WBGene00002188(kgb-2)
Genomic Alteration: WBGene00002187(kgb-1), WBGene00002188(kgb-2)
Availability: available
Source References: EMPTY
Synonyms: kgb-1(um3) kgb-2(km16) IV.
Alternate IDs: WB-STRAIN:KB7, CGC_KB7
Notes: Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)]|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00023468 Copy
http://www.wormbase.org/db/get?name=WBStrain00023465
Source Database: WormBase (WB)
Affected Genes: WBGene00002187(kgb-1)
Genomic Alteration: WBGene00002187(kgb-1)
Availability: available
Source References: PMID:33674585, PMID:37310929, PMID:38573858
Synonyms: kgb-1(um3) IV.
Alternate IDs: WB-STRAIN:KB3, CGC_KB3
Notes: Mutagen:UV/Psoralen|"Temperature sensitive sterile at 26C, with EMO oocytes. Grows at 15C or 20C."
Proper citation: RRID:WB-STRAIN:WBStrain00023465 Copy
http://www.wormbase.org/db/get?name=WBStrain00023466
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001598(glh-1)|WBGene00001601(glh-4)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001598(glh-1), WBGene00001601(glh-4)
Availability: available
Source References: EMPTY
Synonyms: glh-4(gk225) glh-1(ok439) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:KB4, CGC_KB4
Notes: Made_by: Chris Yee|"Mutagen:UV/TMP"|"Pick GFP+ to maintain balanced stock. Heterozygotes are superficially wild-type GFP+ and segregate wild-type GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP glh-4 glh-1 homozygotes (sterile; incompletely penetrant). NOTE (K. Bennett, 2012): KB4 strain is only 63% sterile at 20C and 92% sterile at 26C (Spike et al., Genetics 2008 178:1973). glh-1(ok439) is not a null allele."
Proper citation: RRID:WB-STRAIN:WBStrain00023466 Copy
http://www.wormbase.org/db/get?name=WBStrain00023416
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:JU3127
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00023416 Copy
http://www.wormbase.org/db/get?name=WBStrain00023414
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:JU2908
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00023414 Copy
http://www.wormbase.org/db/get?name=WBStrain00023419
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369, PMID:38865452
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:JU3132
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00023419 Copy
http://www.wormbase.org/db/get?name=WBStrain00023497
Source Database: WormBase (WB)
Availability: available
Source References: PMID:30254025
Synonyms: ceIs269 I.
Alternate IDs: WB-STRAIN:KG4687, CGC_KG4687
Notes: ceIs269 [unc-129p::tomm-20::Venus + unc-129p::mCherry + ttx-3p::RFP]; Integration in Chromosome I (near genetic position -3.20 or 1.14). The ttx-3 marker is quite faint in this strain especially in larvae. The tomm-20::Venus construct was injected at 0.5 ng/ ul in the strain used to make this integrant, so virtually all of the visible tomm-20::Venus signal s associated with mitochondria with essentially no background. The unc-129p::mCherry marker is expressed at a very low level that are detectable only with a sensitive camera (and often not by eye at 1000X). In strains lacking mitochondria in the dorsal cord, use the camera to focus on the mCherry in the dorsal cord, then acquire in the YFP channel.|"Made_by: Logan Morrison"|"Mutagen:Gamma Rays"
Proper citation: RRID:WB-STRAIN:WBStrain00023497 Copy
http://www.wormbase.org/db/get?name=WBStrain00023494
Source Database: WormBase (WB)
Affected Genes: WBGene00004719(sad-1)
Genomic Alteration: WBGene00004719(sad-1)
Availability: available
Source References: EMPTY
Synonyms: sad-1(ce749) X.
Alternate IDs: WB-STRAIN:KG4400, CGC_KG4400
Notes: Superficially wild-type on plates. Shows defects in the transport and capture of dense core vesicles and synaptic vesicles in cholinergic motor neurons. Suppresses organelle accumulation (lysosomes, early endosomes, Golgi) in axons in an unc-16(-) background. Reference: Edwards SL, et al. Genetics. 2015 Sep;201(1):91-116. Edwards SL, et al. Genetics. 2015 Sep;201(1):117-41.
Proper citation: RRID:WB-STRAIN:WBStrain00023494 Copy
http://www.wormbase.org/db/get?name=WBStrain00023495
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30254025
Synonyms: ceIs276 [Punc17b::CRE]
Alternate IDs: WB-STRAIN:KG4636
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00023495 Copy
http://www.wormbase.org/db/get?name=WBStrain00023413
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:JU2907
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00023413 Copy
http://www.wormbase.org/db/get?name=WBStrain00023498
Source Database: WormBase (WB)
Affected Genes: WBGene00006840(unc-116)|WBGene00012759(sup-1)
Genomic Alteration: WBGene00006840(unc-116), WBGene00012759(sup-1)
Availability: available
Source References: PMID:30254025
Synonyms: unc-116(ce815[LoxP+sup-1(e995)+LoxP]) III.
Alternate IDs: WB-STRAIN:KG4731, CGC_KG4731
Notes: Lox P sites in 3' UTR and 4th intron flank kinesin motor domain sequences; sup-1(e995) mini-gene inserted in second intron. Appears wild-type on plates and in quantitative locomotion assays. Can be used to conditionally delete gene sequences encoding the conventional kinesin motor domain in a tissue specific manner by driving expression of Cre recombinase in the tissue of interest. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.
Proper citation: RRID:WB-STRAIN:WBStrain00023498 Copy
http://www.wormbase.org/db/get?name=WBStrain00023499
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30254025
Synonyms: unc-116(ce815[LoxP1/unc-116/sup-1/LoxP2]);ceIs276[Punc17b::CRE]
Alternate IDs: WB-STRAIN:KG4742
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00023499 Copy
http://www.wormbase.org/db/get?name=WBStrain00023492
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: ceIs201 I.
Alternate IDs: WB-STRAIN:KG4247, CGC_KG4247
Notes: ceIs201 [unc-17p::ins-22::Venus + unc-17p::RFP + unc-17p::ssmCherry + myo-2p::RFP]; integration site maps to I:0.77. Expresses INS-22::Venus to mark Dense Core Vesicles in the cholinergic nervous system, including the ventral cord cholinergic motor neurons. Also expresses mCherry in the same neurons to help identify the boundaries of the somas, axons, and dendrites. ssmCherry is mCherry with a secretion signal on its N-terminus, which is constitutively secreted and taken up by coelomoctyes in the pseuodcoelomic space, making it a useful marker for those coelomocytes. The INS-22::Venus also gets secreted by DCVs and taken up by coelomocytes. The myo-2::RFP is a co-tranformation marker that lights up the pharyngeal muscle cells and is useful for crossing the integrant into various mutant backgrounds. Reference: Hoover CM, et al. Genetics. 2014 Mar;196(3):745-65.|"Mutagen:Gamma Rays"
Proper citation: RRID:WB-STRAIN:WBStrain00023492 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.