Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 104 showing 2061 ~ 2080 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00005596

http://www.wormbase.org/db/get?name=WBStrain00005596

Source Database: WormBase (WB)
Affected Genes: WBGene00007630(har-1)
Genomic Alteration: WBGene00007630(har-1)
Availability: available
Source References: EMPTY
Synonyms: har-1(ad2155) III.
Alternate IDs: WB-STRAIN:DA2155, CGC_DA2155
Notes: Hemiasterlin resistant. Maintain under normal conditions. Reference: Zubovych IO, et al. Mol Biol Cell. 2010 Mar 15;21(6):956-69.

Proper citation: RRID:WB-STRAIN:WBStrain00005596 Copy   


  • RRID:WB-STRAIN:WBStrain00005593

http://www.wormbase.org/db/get?name=WBStrain00005593

Source Database: WormBase (WB)
Affected Genes: WBGene00001173(egl-4)
Genomic Alteration: WBGene00001173(egl-4)
Availability: available
Source References: EMPTY
Synonyms: egl-4(ks62) IV; adEx2143.
Alternate IDs: WB-STRAIN:DA2143, CGC_DA2143
Notes: adEx2143 [tax-4p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. pkg-1 is the new name of egl-4. Reference: You et al (2008) Cell Metab 7(3):249-57.

Proper citation: RRID:WB-STRAIN:WBStrain00005593 Copy   


  • RRID:WB-STRAIN:WBStrain00005590

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005590

Source Database: WormBase (WB)
Affected Genes: WBGene00004780(ser-7)
Genomic Alteration: WBGene00004780(ser-7)
Availability: available
Source References: PMID:33007049, PMID:38514005, PMID:39025433
Synonyms: ser-7(tm1325) X
Alternate IDs: WB-STRAIN:DA2100, CGC_DA2100
Notes: Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00060976 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060405 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005590 Copy   


  • RRID:WB-STRAIN:WBStrain00005509

http://www.wormbase.org/db/get?name=WBStrain00005509

Source Database: WormBase (WB)
Affected Genes: WBGene00001142(eat-13)|WBGene00006750(unc-10)
Genomic Alteration: WBGene00001142(eat-13), WBGene00006750(unc-10)
Availability: available
Source References: PMID:8462849
Synonyms: unc-10(e102) eat-13(ad522) X.
Alternate IDs: WB-STRAIN:DA726, CGC_DA726
Notes: Unc. Eat mutant. Slippery pharynx-Slight relaxation defect.

Proper citation: RRID:WB-STRAIN:WBStrain00005509 Copy   


  • RRID:WB-STRAIN:WBStrain00005506

http://www.wormbase.org/db/get?name=WBStrain00005506

Source Database: WormBase (WB)
Affected Genes: WBGene00020770(eat-17)
Genomic Alteration: WBGene00020770(eat-17)
Availability: available
Source References: PMID:8462849
Synonyms: eat-17(ad707) X.
Alternate IDs: WB-STRAIN:DA707, CGC_DA707
Notes: Eat mutant. Stuffs corpus and isthmus. Abnormality in m6 and m7 contraction timing. Displays clumping behavior; isolated in an RC301 background, so it's likely to have the RC301 bor-1 mutation.

Proper citation: RRID:WB-STRAIN:WBStrain00005506 Copy   


  • RRID:WB-STRAIN:WBStrain00005504

http://www.wormbase.org/db/get?name=WBStrain00005504

Source Database: WormBase (WB)
Affected Genes: WBGene00006772(unc-36)
Genomic Alteration: WBGene00006772(unc-36)
Availability: available
Source References: PMID:38338915
Synonyms: unc-36(ad698) III.
Alternate IDs: WB-STRAIN:DA698, CGC_DA698
Notes: EMS - RC301 background|"Unc. Eat - slippery pharynx, slow pumping."

Proper citation: RRID:WB-STRAIN:WBStrain00005504 Copy   


  • RRID:WB-STRAIN:WBStrain00005502

http://www.wormbase.org/db/get?name=WBStrain00005502

Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1)
Availability: available
Source References: PMID:2401010
Synonyms: nDf16/qC1 [dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:DA686, CGC_DA686
Notes: Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. dpy-19(e1259) is temperature sensitive. Maintain by picking WT. [Checked 11/94 with sma-3 and nDf16 is present.]|"Mutagen:Gamma rays (nDf16)"

Proper citation: RRID:WB-STRAIN:WBStrain00005502 Copy   


  • RRID:WB-STRAIN:WBStrain00005589

http://www.wormbase.org/db/get?name=WBStrain00005589

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)
Genomic Alteration: WBGene00003514(myo-2)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:DA2038
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005589 Copy   


  • RRID:WB-STRAIN:WBStrain00005587

http://www.wormbase.org/db/get?name=WBStrain00005587

Source Database: WormBase (WB)
Affected Genes: WBGene00004778(ser-3)
Genomic Alteration: WBGene00004778(ser-3)
Availability: available
Source References: EMPTY
Synonyms: ser-3(ad1774) I.
Alternate IDs: WB-STRAIN:DA1774, CGC_DA1774
Notes: Deletion of bp 433-1994 of K02F2.6.|"Made_by: T. Niacaris"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00005587 Copy   


  • RRID:WB-STRAIN:WBStrain00005519

http://www.wormbase.org/db/get?name=WBStrain00005519

Source Database: WormBase (WB)
Affected Genes: WBGene00001147(eat-18)
Genomic Alteration: WBGene00001147(eat-18)
Availability: available
Source References: EMPTY
Synonyms: eat-18(ad820) I.
Alternate IDs: WB-STRAIN:DA820, CGC_DA820
Notes: Semidominant Eat. pka eat-18.

Proper citation: RRID:WB-STRAIN:WBStrain00005519 Copy   


  • RRID:WB-STRAIN:WBStrain00005518

http://www.wormbase.org/db/get?name=WBStrain00005518

Source Database: WormBase (WB)
Affected Genes: WBGene00001135(eat-4)
Genomic Alteration: WBGene00001135(eat-4)
Availability: available
Source References: PMID:8462849
Synonyms: eat-4(ad819) III.
Alternate IDs: WB-STRAIN:DA819, CGC_DA819
Notes: Abnormal feeding.

Proper citation: RRID:WB-STRAIN:WBStrain00005518 Copy   


  • RRID:WB-STRAIN:WBStrain00005516

http://www.wormbase.org/db/get?name=WBStrain00005516

Source Database: WormBase (WB)
Affected Genes: WBGene00001137(eat-6)
Genomic Alteration: WBGene00001137(eat-6)
Availability: available
Source References: EMPTY
Synonyms: eat-6(ad792) V.
Alternate IDs: WB-STRAIN:DA792, CGC_DA792
Notes: Eat. Relaxation defective. Lib. Cold sensitive.

Proper citation: RRID:WB-STRAIN:WBStrain00005516 Copy   


  • RRID:WB-STRAIN:WBStrain00005511

http://www.wormbase.org/db/get?name=WBStrain00005511

Source Database: WormBase (WB)
Affected Genes: WBGene00006829(unc-101)
Genomic Alteration: WBGene00006829(unc-101)
Availability: available
Source References: PMID:8462849
Synonyms: adDf538 unc-101(m1) I.
Alternate IDs: WB-STRAIN:DA734, CGC_DA734
Notes: Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. Unc. adDf538 previously called phm-2(ad538).

Proper citation: RRID:WB-STRAIN:WBStrain00005511 Copy   


  • RRID:WB-STRAIN:WBStrain00005599

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005599

Source Database: WormBase (WB)
Affected Genes: WBGene00003232(mgl-1)|WBGene00003233(mgl-2)
Genomic Alteration: WBGene00003232(mgl-1), WBGene00003233(mgl-2)
Availability: available
Source References: PMID:38362034
Synonyms: mgl-2(tm355) I; mgl-1(tm1811) X.
Alternate IDs: WB-STRAIN:DA2250, CGC_DA2250
Notes: Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7.

Proper citation: RRID:WB-STRAIN:WBStrain00005599 Copy   


  • RRID:WB-STRAIN:WBStrain00005597

http://www.wormbase.org/db/get?name=WBStrain00005597

Source Database: WormBase (WB)
Affected Genes: WBGene00000903(daf-7)
Genomic Alteration: WBGene00000903(daf-7)
Availability: available
Source References: EMPTY
Synonyms: daf-7(e1372) III; adEx2202.
Alternate IDs: WB-STRAIN:DA2202, CGC_DA2202
Notes: adEx2202 [gpa-4p::daf-7 + rol-6p::GFP]. Rescues Daf-c. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57.

Proper citation: RRID:WB-STRAIN:WBStrain00005597 Copy   


  • RRID:WB-STRAIN:WBStrain00005510

http://www.wormbase.org/db/get?name=WBStrain00005510

Source Database: WormBase (WB)
Affected Genes: WBGene00001140(eat-9)|WBGene00006829(unc-101)
Genomic Alteration: WBGene00001140(eat-9), WBGene00006829(unc-101)
Availability: available
Source References: PMID:8462849
Synonyms: unc-101(m1) eat-9(e2337) I.
Alternate IDs: WB-STRAIN:DA729, CGC_DA729
Notes: Unc. Abnormal feeding. Irregular pumping.

Proper citation: RRID:WB-STRAIN:WBStrain00005510 Copy   


  • RRID:WB-STRAIN:WBStrain00005598

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005598

Source Database: WormBase (WB)
Affected Genes: WBGene00004978(spg-7)
Genomic Alteration: WBGene00004978(spg-7)
Availability: available
Source References: EMPTY
Synonyms: spg-7(ad2249) I.
Alternate IDs: WB-STRAIN:DA2249, CGC_DA2249
Notes: Hemiasterlin resistant. Maintain under normal conditions. Reference: Zubovych IO, et al. Mol Biol Cell. 2010 Mar 15;21(6):956-69.

Proper citation: RRID:WB-STRAIN:WBStrain00005598 Copy   


  • RRID:WB-STRAIN:WBStrain00005525

http://www.wormbase.org/db/get?name=WBStrain00005525

Source Database: WormBase (WB)
Affected Genes: WBGene00001187(egl-19)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00001187(egl-19), WBGene00006772(unc-36)
Availability: available
Source References: PMID:9321386
Synonyms: unc-36(e251) III; egl-19(n582) IV.
Alternate IDs: WB-STRAIN:DA945, CGC_DA945
Notes: Unc. Semidominant Egl, Lon, Slow and Floppy

Proper citation: RRID:WB-STRAIN:WBStrain00005525 Copy   


  • RRID:WB-STRAIN:WBStrain00005520

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005520

Source Database: WormBase (WB)
Affected Genes: WBGene00001196(egl-30)
Genomic Alteration: WBGene00001196(egl-30)
Availability: available
Source References: PMID:8630258
Synonyms: egl-30(ad805) I.
Alternate IDs: WB-STRAIN:DA823, CGC_DA823
Notes: Made_by: Duttweiler/Avery|"Suppressor of gpb-2 (a.k.a. eat-11) arecoline hypersensitivity. Unc. Egl."

Proper citation: RRID:WB-STRAIN:WBStrain00005520 Copy   


  • RRID:WB-STRAIN:WBStrain00005541

http://www.wormbase.org/db/get?name=WBStrain00005541

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: +/eT1 III; adDf1059/eT1 V.
Alternate IDs: WB-STRAIN:DA1060, CGC_DA1060
Notes: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs.|"Mutagen:Gamma Rays"

Proper citation: RRID:WB-STRAIN:WBStrain00005541 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X