Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
VC145
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00035541 Caenorhabditis elegans pes-7(gk123) I. F09C3.1. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00003980(pes-7) WBGene00003980(pes-7) WB-STRAIN:WBStrain00035541 WormBase (WB) WB available WB-STRAIN:VC145, CGC_VC145 2026-09-12 11:17:24 0
VC166
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00035551 Caenorhabditis elegans ppt-1(gk131) V. F44C4.5. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00004092(ppt-1) WBGene00004092(ppt-1) WB-STRAIN:WBStrain00035551 WormBase (WB) WB available WB-STRAIN:VC166, CGC_VC166 2026-09-12 11:17:24 0
VC165
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00035550 Caenorhabditis elegans ttn-1(gk135) V. H05O09.1 W06H8.8 Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006436(ttn-1) WBGene00006436(ttn-1) WB-STRAIN:WBStrain00035550 WormBase (WB) WB available WB-STRAIN:VC165, CGC_VC165 2026-09-12 11:17:24 0
VC168
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00035553 Caenorhabditis elegans ppt-1(gk134) V. F44C4.5. Dpyish.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00004092(ppt-1) WBGene00004092(ppt-1) WB-STRAIN:WBStrain00035553 WormBase (WB) WB available WB-STRAIN:VC168, CGC_VC168 2026-09-12 11:17:25 0
VC170
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00035555 Caenorhabditis elegans cki-1(gk132)/mIn1 II Mutagen:UV/TMP|"T05A6.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk132 homozygotes (embryonic arrest). Pick WT and check for correct segregation of progeny to maintain."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000516(cki-1)|WBGene00001072(dpy-10) WBGene00000516(cki-1), WBGene00001072(dpy-10) WB-STRAIN:WBStrain00035555 WormBase (WB) WB available PMID:38522217 WB-STRAIN:VC170, CGC_VC170 2026-09-12 11:17:25 1
VC169
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00035554 Caenorhabditis elegans tbb-2(gk129) III. C36E8.5. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006537(tbb-2) WBGene00006537(tbb-2) WB-STRAIN:WBStrain00035554 WormBase (WB) WB available WB-STRAIN:VC169, CGC_VC169 2026-09-12 11:17:25 0
VC172
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00035557 Caenorhabditis elegans cep-1(gk138) I. F52B5.5. Superficially wild type.|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00060693 added based on published strain data identified by Textpresso literature search."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000467(cep-1) WBGene00000467(cep-1) WB-STRAIN:WBStrain00035557 WormBase (WB) WB available PMID:31704915
PMID:33262405
WB-STRAIN:VC172, CGC_VC172 2026-09-12 11:17:25 1
VC171
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00035556 Caenorhabditis elegans smf-2(gk133) X. K11G12.3. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00004877(smf-2) WBGene00004877(smf-2) WB-STRAIN:WBStrain00035556 WormBase (WB) WB available WB-STRAIN:VC171, CGC_VC171 2026-09-12 11:17:25 1
VC175
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00035560 Caenorhabditis elegans sod-4(gk101) III. F55H2.1. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00004933(sod-4) WBGene00004933(sod-4) WB-STRAIN:WBStrain00035560 WormBase (WB) WB available WB-STRAIN:VC175, CGC_VC175 2026-09-12 11:17:25 1
VC128
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00035525 Caenorhabditis elegans mtl-2(gk125) V. Mutagen:UV/TMP|"T08G5.10. Superficially wild type."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00003474(mtl-2) WBGene00003474(mtl-2) WB-STRAIN:WBStrain00035525 WormBase (WB) WB available PMID:38790689 WB-STRAIN:VC128, CGC_VC128 2026-09-12 11:17:24 0
VC133
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00035529 Caenorhabditis elegans C05D11.8(gk47) III. C05D11.8. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00015485(fhip-1) WBGene00015485(fhip-1) WB-STRAIN:WBStrain00035529 WormBase (WB) WB available WB-STRAIN:VC133, CGC_VC133 2026-09-12 11:17:24 0
VC118
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00035520 Caenorhabditis elegans haf-7(gk46) V. Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y50E8A.16. Superficially wild type." WBGene00001817(haf-7) WBGene00001817(haf-7) WB-STRAIN:WBStrain00035520 WormBase (WB) WB available WB-STRAIN:VC118, CGC_VC118 2026-09-12 11:17:24 0
VC125
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00035522 Caenorhabditis elegans tyra-3(ok325) X. M03F4.3. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"Supplementary_genotype tyra-3(ok325)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00060134 paper added based on AFP_Strain data." WBGene00006475(tyra-3) WBGene00006475(tyra-3) WB-STRAIN:WBStrain00035522 WormBase (WB) WB available PMID:32847964
PMID:37728328
PMID:37773959
WB-STRAIN:VC125, CGC_VC125 2026-09-12 11:17:24 1
VC119
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00035521 Caenorhabditis elegans ptb-1(gk113) II. D2089.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00004207(ptb-1) WBGene00004207(ptb-1) WB-STRAIN:WBStrain00035521 WormBase (WB) WB available WB-STRAIN:VC119, CGC_VC119 2026-09-12 11:17:24 0
VC141
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00035537 Caenorhabditis elegans zif-1(gk117) III. F59B2.6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006977(zif-1) WBGene00006977(zif-1) WB-STRAIN:WBStrain00035537 WormBase (WB) WB available WB-STRAIN:VC141, CGC_VC141 2026-09-12 11:17:24 4
VC140
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00035536 Caenorhabditis elegans eif-3.K(gk126) V. Mutagen:UV/TMP|"T16G1.11. Superficially wild type."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001233(eif-3.K) WBGene00001233(eif-3.K) WB-STRAIN:WBStrain00035536 WormBase (WB) WB available WB-STRAIN:VC140, CGC_VC140 2026-09-12 11:17:24 0
VC142
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00035538 Caenorhabditis elegans dgk-2(gk124) X. F46H6.2. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000959(dgk-2) WBGene00000959(dgk-2) WB-STRAIN:WBStrain00035538 WormBase (WB) WB available WB-STRAIN:VC142, CGC_VC142 2026-09-12 11:17:24 0
VC135
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00035531 Caenorhabditis elegans tag-4(gk128) I. Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK337.4. Superficially wild type." WBGene00006399(tag-4) WBGene00006399(tag-4) WB-STRAIN:WBStrain00035531 WormBase (WB) WB available WB-STRAIN:VC135, CGC_VC135 2026-09-12 11:17:24 0
VC138
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00035534 Caenorhabditis elegans elo-1(gk48) IV. F56H1.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001239(elo-1) WBGene00001239(elo-1) WB-STRAIN:WBStrain00035534 WormBase (WB) WB available WB-STRAIN:VC138, CGC_VC138 2026-09-12 11:17:24 1
VC100
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00035508 Caenorhabditis elegans unc-112(r367) V; gkDf2 X. gkDf2. Multiple genes deleted. Deletion extents determined by oligo array CGH. Deletion size: ~44kb. Deletion left flank: TTAGTAAGCCGGAAAATGGATTTCGCTTTTCTCCTATTGAGAAACCTAAA. Deletion right flank: CTACCTTTCAAAATGAATAGCAACCACTTTTTCGACGAAGAAATGTTCGT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006836(unc-112) WBGene00006836(unc-112) WB-STRAIN:WBStrain00035508 WormBase (WB) WB available WB-STRAIN:VC100, CGC_VC100 2026-09-12 11:17:24 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.