Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00003901

Source Database: WormBase (WB)
Availability: available
Source References: PMID:34496255, PMID:37416472, PMID:37549461, PMID:39149885, PMID:39212733
Synonyms: byIs161.
Alternate IDs: WB-STRAIN:BR5270, CGC_BR5270
Notes: Associated protein: Human Pro-aggregating tau|"byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted (line A). Integration site not mapped. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603."|"byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. Pan-neuronal overexpression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted (line A). Integration site not mapped. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603."|"Made_by: C. Fatouros"|"Mutagen:Gamma radiation"|"Transgene expression: Pan-neuronal + phyrengeal muscle (marker)"|"WBStrain provided so WBPaper00061894 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00003901 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003864

Source Database: WormBase (WB)
Availability: available
Synonyms: bqSi294 II; bqSi542 IV.
Alternate IDs: WB-STRAIN:BN544, CGC_BN544
Notes: bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi542 [unc-47p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in GABAergic motor neurons and red nuclei elsewhere.

Proper citation: RRID:WB-STRAIN:WBStrain00003864 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003861

Source Database: WormBase (WB)
Availability: available
Source References: PMID:36645076, PMID:37831769
Synonyms: bqSi294 II; bqSi506 IV.
Alternate IDs: WB-STRAIN:BN507, CGC_BN507
Notes: bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi506 [rgef-1p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in neurons and red nuclei elsewhere.|"Supplementary_genotype bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi506 [rgef-1p::FLP D5 + unc-119(+)] IV"

Proper citation: RRID:WB-STRAIN:WBStrain00003861 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003874

Source Database: WormBase (WB)
Affected Genes: WBGene00000100(ajm-1)|WBGene00001159(eff-1)
Genomic Alteration: WBGene00000100(ajm-1), WBGene00001159(eff-1)
Availability: available
Synonyms: eff-1(hy21) II; jcIs1 IV.
Alternate IDs: WB-STRAIN:BP76, CGC_BP76
Notes: jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Temperature sensitive. Cell fusion-defective embryos, larvae and adults at 25C. Cell fusion defects are less penetrant at 15C. Egl, Unv, Pvl, Dpy and 2% Muv at 20C and 25C. Mutants have body morphological defects and bulged tails at all temperature, male tails are leptoderan. Partial sterility of hermaphrodites: brood size is 48 at 25C. ME=0. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and the gene encoding the antigen recognized by the monoclonal antibody MH27. jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Mohler WA, et al. Curr Biol. 1998 Sep 24;8(19):1087-90.

Proper citation: RRID:WB-STRAIN:WBStrain00003874 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003871

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; bqSi711 IV.
Alternate IDs: WB-STRAIN:BN711, CGC_BN711
Notes: bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Constitutive co-expression of codon-optimised FLP and fluorescent mNeonGreen in the germ line. Reference: Macias-Leon J & Askjaer P. (2018): Efficient FLP-mediated germ-line recombination in C. elegans. Micropublication:biology. Dataset. https:|"Made_by: Javier Macas-Len"

Proper citation: RRID:WB-STRAIN:WBStrain00003871 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003887

Source Database: WormBase (WB)
Affected Genes: WBGene00000102(akt-1)
Genomic Alteration: WBGene00000102(akt-1)
Availability: available
Source References: PMID:38634692
Synonyms: akt-1(mg306) V.
Alternate IDs: WB-STRAIN:BQ1, CGC_BQ1
Notes: Hid.

Proper citation: RRID:WB-STRAIN:WBStrain00003887 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003817

Source Database: WormBase (WB)
Affected Genes: WBGene00003401(mpk-1)
Genomic Alteration: WBGene00003401(mpk-1)
Availability: available
Source References: PMID:37122724
Synonyms: mpk-1(sbj10) III.
Alternate IDs: WB-STRAIN:BJS737, CGC_BJS737
Notes: Made_by: Julien N Bianco|"Temperature sensitive allele of mpk-1, bypasses UV sensitivity of csb-1 mutant at 20-25C. Reference: Bianco JN & Schumacher B. Nucleic Acids Res. 2018 May 21. doi: 10.1093/nar/gky404."

Proper citation: RRID:WB-STRAIN:WBStrain00003817 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003813

Source Database: WormBase (WB)
Affected Genes: WBGene00004743(scm-1)|WBGene00004912(sng-1)|WBGene00004979(sph-1)
Genomic Alteration: WBGene00004743(scm-1), WBGene00004912(sng-1), WBGene00004979(sph-1)
Availability: available
Synonyms: scm-1(hd30) I; sph-1(ox278) IV; sng-1(ok234) X.
Alternate IDs: WB-STRAIN:BJ21, CGC_BJ21
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00003813 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003897

Source Database: WormBase (WB)
Affected Genes: WBGene00000500(chn-1)
Genomic Alteration: WBGene00000500(chn-1)
Availability: available
Source References: PMID:39384041
Synonyms: chn-1(by155) I.
Alternate IDs: WB-STRAIN:BR2823, CGC_BR2823
Notes: 989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.|"Made_by: Hoppe/Sperl"

Proper citation: RRID:WB-STRAIN:WBStrain00003897 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003894

Source Database: WormBase (WB)
Affected Genes: WBGene00003877(pept-1)
Genomic Alteration: WBGene00003877(pept-1)
Availability: available
Source References: PMID:33157031, PMID:38991033, PMID:39284915
Synonyms: pept-1(lg601) X.
Alternate IDs: WB-STRAIN:BR2742, CGC_BR2742
Notes: Made_by: Elegene|"Mutagen:UV/TMP"|"Slow postembryonic development. Reduced brood size. Previously known as pep-2. [NOTE: the genotype of this strain was previously incorrectly annotated as lg1601. The correct allele name is lg601.] Reference: Meissner B, et al. J Biol Chem. 2004 Aug 27;279(35):36739-45."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00003894 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003829

Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: available
Source References: PMID:34534446
Synonyms: inIs179 [ida-1p::GFP] II; him-8(e1489) IV
Alternate IDs: WB-STRAIN:BL5717, CGC_BL5717
Notes: inIs179 [ida-1p::GFP]. GFP is expressed in a subset of neurons and the neuroendocrine uv1 cells of the vulva. Identified neurons include ADE, ALA, ASI, ASK, AUA, ASG, AVH, AVJ, AVK, VC, HSN, PDE, PVP, PHA, PHB, PHC. Male sex-specific neurons include CA and some ray neurons. Plasmid pida-1::GFP 7.6 was injected into N2 and integrated to generate BL5715, then crossed into him-8(e1489) background.|"Made_by: T Zahn/P MacMorris"|"Mutagen:Gamma rays"

Proper citation: RRID:WB-STRAIN:WBStrain00003829 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003902

Source Database: WormBase (WB)
Availability: available
Source References: PMID:37549461, PMID:39149885
Synonyms: byIs162.
Alternate IDs: WB-STRAIN:BR5271, CGC_BR5271
Notes: byIs162 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line A). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.|"byIs162 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal overexpression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line A). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603."|"Made_by: C. Fatouros"|"Mutagen:Gamma radiation"

Proper citation: RRID:WB-STRAIN:WBStrain00003902 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003936

Source Database: WormBase (WB)
Affected Genes: WBGene00001609(glp-1)|WBGene00006768(unc-32)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00001609(glp-1), WBGene00006768(unc-32), WBGene00006772(unc-36)
Availability: available
Source References: PMID:9043073
Synonyms: unc-32(e189) glp-1(oz112)/unc-36(e251) glp-1(q175) III.
Alternate IDs: WB-STRAIN:BS913, CGC_BS913
Notes: Heterozygotes are WT and segregate WT and Uncs (both Unc-32 and Unc-36). Tumorous germline phenotype in both hermaphrodites and males; semidominant and temperature sensitive. Even at permissive temperatures (15-20C) brood size is very small (10-20 viable progeny) because of the overproliferation of germ cells at the expense of oogenesis.|"No longer available from the CGC catalogue 24/04/2020"

Proper citation: RRID:WB-STRAIN:WBStrain00003936 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003934

Source Database: WormBase (WB)
Affected Genes: WBGene00001482(fog-2)
Genomic Alteration: WBGene00001482(fog-2)
Availability: available
Source References: PMID:32338603, PMID:38967024
Synonyms: fog-2(oz40) V.
Alternate IDs: WB-STRAIN:BS553, CGC_BS553
Notes: Male/female strain. Maintain by mating.|"Mutagen: Psoralen"|"WBStrain mapped, WBPaper00059605 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00003934 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00004001

Source Database: WormBase (WB)
Affected Genes: WBGene00000936(dbl-1)
Genomic Alteration: WBGene00000936(dbl-1)
Availability: available
Synonyms: ctIs40 X.
Alternate IDs: WB-STRAIN:BW1940, CGC_BW1940
Notes: ctIs40 [dbl-1(+) + sur-5::GFP]. Lon. dbl-1 over-expressing line from injection of constructs ZC421 and pTG98.

Proper citation: RRID:WB-STRAIN:WBStrain00004001 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003942

Source Database: WormBase (WB)
Affected Genes: WBGene00004057(pmk-3)
Genomic Alteration: WBGene00004057(pmk-3)
Availability: available
Source References: PMID:37310929, PMID:39532199
Synonyms: pmk-3(ok169).
Alternate IDs: WB-STRAIN:BS3383, CGC_BS3383
Notes: F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.|"Made_by: Barstead/Moulder"

Proper citation: RRID:WB-STRAIN:WBStrain00003942 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003952

Source Database: WormBase (WB)
Affected Genes: WBGene00001863(him-4)
Genomic Alteration: WBGene00001863(him-4)
Availability: available
Source References: PMID:38177158
Synonyms: him-4(rh319) X.
Alternate IDs: WB-STRAIN:BT12, CGC_BT12
Notes: Him. Reference: Vogel BE, Hedgecock EM. (2001) Development. 128:883-94.

Proper citation: RRID:WB-STRAIN:WBStrain00003952 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00004020

Source Database: WormBase (WB)
Affected Genes: WBGene00001399(fat-7)
Genomic Alteration: WBGene00001399(fat-7)
Availability: available
Source References: PMID:33009389, PMID:36653384, PMID:37541249
Synonyms: fat-7(wa36) V.
Alternate IDs: WB-STRAIN:BX153, CGC_BX153
Notes: Made_by:|"Supplementary_genotype fat-7(wa36)"

Proper citation: RRID:WB-STRAIN:WBStrain00004020 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00004018

Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: PMID:38374083
Synonyms: lin-15B&lin-15A(n765) X; waEx16.
Alternate IDs: WB-STRAIN:BX115, CGC_BX115
Notes: waEx16 [fat-6::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.

Proper citation: RRID:WB-STRAIN:WBStrain00004018 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00004015

Source Database: WormBase (WB)
Affected Genes: WBGene00001397(fat-5)
Genomic Alteration: WBGene00001397(fat-5)
Availability: available
Source References: PMID:32302543, PMID:36653384, PMID:37541249
Synonyms: fat-5(tm420) V.
Alternate IDs: WB-STRAIN:BX107, CGC_BX107
Notes: Mutagen:UV/TMP|"Received new stock with confirmed deletion from Jennifer Watts 07/16/2009."|"Supplementary_genotype fat-5(tm420)"|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00004015 Copy   

•   Source: WormBase