Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
meg-1(ax4534[meg-1::gfp]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054772 | Caenorhabditis elegans | meg-1(ax4534[meg-1::gfp]) X. | GFP tag inserted at C-terminus of the endogenous meg-1 locus by CRISPR. Reference: Cassani M & Seydoux G. Development 2022 Nov 1;149(21):dev200920. doi: 10.1242/dev.200920. PMID: 36196602. | WBGene00010492(meg-1) | WBGene00010492(meg-1) | WB-STRAIN:WBStrain00054772 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:41 | 0 | ||||
|
par-1(ax4202[par-1(T983A)]) V/nT1[qIs51] (IV;V); meg-3(ax3054[meg-3::meGFP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054774 | Caenorhabditis elegans | par-1(ax4202[par-1(T983A)]) V/nT1[qIs51] (IV;V); meg-3(ax3054[meg-3::meGFP]) X. | meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay dead embryos), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Replacement of threonine 983 with alanine eliminates PAR-1 asymmetry. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118 | WBGene00001569(meg-3)|WBGene00003916(par-1) | WBGene00001569(meg-3), WBGene00003916(par-1) | WB-STRAIN:WBStrain00054774 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:41 | 0 | ||||
|
hsr-9(xoe17) I; brd-1(xoe18) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054770 | Caenorhabditis elegans | hsr-9(xoe17) I; brd-1(xoe18) III. | Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122. | WBGene00000265(brd-1)|WBGene00002027(hsr-9) | WBGene00000265(brd-1), WBGene00002027(hsr-9) | WB-STRAIN:WBStrain00054770 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:42 | 0 | ||||
|
par-1(ax4208[meGFP::delta-KA1]) V/nT1[qIs51] (IV;V). Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054775 | Caenorhabditis elegans | par-1(ax4208[meGFP::delta-KA1]) V/nT1[qIs51] (IV;V). | meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay viable progeny that are completely sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. par-1(ax4208) removes the KA1 domain from a GFP-tagged version of PAR-1. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118 | WBGene00001569(meg-3)|WBGene00003916(par-1) | WBGene00001569(meg-3), WBGene00003916(par-1) | WB-STRAIN:WBStrain00054775 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:41 | 0 | ||||
|
npp-14(ax4543) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054778 | Caenorhabditis elegans | npp-14(ax4543) I. | ax4523 is a deletion residues 24-1387 of the npp-14 coding region. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans | WBGene00003800(npp-14) | WBGene00003800(npp-14) | WB-STRAIN:WBStrain00054778 | WormBase (WB) | WB | unknown | PMID:37254647 | 2026-08-29 09:28:41 | 0 | |||
|
apx-1(q1148[apx-1::3xV5]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054811 | Caenorhabditis elegans | apx-1(q1148[apx-1::3xV5]) V. | 3xV5 tag inserted at C-terminus of endogenous apx-1 locus. APX-1 guide: GACTCGTCATCTGCTGCCATCGG. APX-1 3xV5 repair with mutation (197 nt): CCTATGGCAGCAGATGACGAGTCGTCGTTTCGAGTCGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTAGATAGTACTGGAAAGCCAATCCCAAACCCACTCCTCGGACTTGATAGCACCGGTAAGCCTATCCCTAACCCACTCCTCGGACTTGATAGCACCTAAACAACAGCTCGACGACGAGATTTACAATAATT.|"CRISPR/Cas9 gene editing was used to insert a 3xV5 tag inserted at the C-terminus of the endogenous apx-1 locus immediately upstream of STOP codon. Animals are fertile and express low levels of APX-1 V5 in adult DTCs." | WBGene00000168(apx-1) | WBGene00000168(apx-1) | WB-STRAIN:WBStrain00054811 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:42 | 0 | ||||
|
nos-3(q902) II; qSi380 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054810 | Caenorhabditis elegans | nos-3(q902) II; qSi380 IV. | Made_by: Jon Doenier|"qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3'UTR::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem-loops in its 3'UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The GFP reporter RNA has three functional boxB stem-loops in its 3'UTR; the mCherry reporter 3'UTR has three mutated boxB stem-loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224." | WBGene00003785(nos-3) | WBGene00003785(nos-3) | WB-STRAIN:WBStrain00054810 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:42 | 0 | ||||
|
sago-2(tor135) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054819 | Caenorhabditis elegans | sago-2(tor135) I. | Null allele of sago-2; detectable by PCR/restriction digest. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https: | WBGene00018921(sago-2) | WBGene00018921(sago-2) | WB-STRAIN:WBStrain00054819 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:42 | 0 | ||||
|
unc-119(ed9) III; irSi24 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054881 | Caenorhabditis elegans | unc-119(ed9) III; irSi24 IV. | irSi24 [pept-1::mCherry::H2B + Cbr-unc-119(+)] IV. Single-copy MosSCI insertion of pept-1 reporter into cxTi10882 site in LG IV. mCherry fluorescence exclusively in intestinal nuclei from the end of embryonic development through adulthood. Generated in N2 background. Reference: Maduro MF, et al. Dev Biol 2015 Aug 1;404(1):66-79. doi: 10.1016/j.ydbio.2015.04.025, PMID:25959238. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00054881 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:44 | 0 | ||||
|
vit-2(ok3211) vit-1(hq532) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054880 | Caenorhabditis elegans | vit-2(ok3211) vit-1(hq532) X. | hq532 is a CRISPR-engineered knockout of vit-1 in vit-2(ok3211) background removing 8 bp from the third exon of vit-1: WT sequence AAAGCATTGAGAAGGAGTCCACAACTGTTGTCCGCGGACGCCGTATCCAAACCGGAATCACG mutated to AAAGCATTGAGAAGGAGTCCACAAC--------GCGGACGCCGTATCCAAACCGGAATCACG. For genotyping, the following primers will produce ~800 bp DNA fragment that can be sequenced. Forward primer: TACCAACGTGTTGCTATCGTTTGCTC. Reverse primer: TTGCTCGAAGAGTGGGGTGAACATTCTC. Strain does not express vit-1 or vit-2. Reference: Zhai C, et al. bioRxiv 2022.06.27.497668; doi: https:|"Made_by: Chao Zhai" | WBGene00006925(vit-1)|WBGene00006926(vit-2) | WBGene00006925(vit-1), WBGene00006926(vit-2) | WB-STRAIN:WBStrain00054880 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:44 | 0 | ||||
|
qySi566 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054925 | Caenorhabditis elegans | qySi566 I. | qySi566 [lin-29p::enol-1a::mNG + loxP] I. Single-copy insertion. Anchor cell specific expression of glycolytic enzyme enol-1a which forms puncta at the invasive side and is also expressed in the nucleus. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 | WB-STRAIN:WBStrain00054925 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:45 | 0 | ||||||
|
qySi565 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054924 | Caenorhabditis elegans | qySi565 I. | qySi565 [lin-29p::pyk-1a::mNG + loxP] I. Single-copy insertion. Anchor cell-specific expression of the mNG-tagged glycolytic enzyme PYK-1A forms puncta at the site of invasion. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 | WB-STRAIN:WBStrain00054924 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:45 | 0 | ||||||
|
otIs181 III; otIs138 X; otIs396. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054885 | Caenorhabditis elegans | otIs181 III; otIs138 X; otIs396. | Made_by: Barbara OBrien in the Miller lab|"otIs181[dat-1::mCherry + ttx-3::mCherry] III. otIs138[ser-2(prom3)::GFP + rol-6(su1006)] X. otIs396 [ace-1prom2::NLS::tagRFP]. Rollers. dat-1::mCherry labels ADE, CEP, and PDE neurons. ttx3::mCherry labels AIY neurons. ser-2(prom3)::GFP labels OLL, PDE, and PVD neurons. ace-1prom2::NLS::tagRFP labels CEP and OLL neurons. PVD can be identified by expression only GFP. An additional pair of GFP-only cells anterior to OLL are occasionally observed in this strain. Can be used to isolate PVD by FACS (green-only). Used by CeNGEN project for RNA-Seq (https:" | WB-STRAIN:WBStrain00054885 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:44 | 0 | ||||||
|
adm-4(qy153[adm-4::mNG + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054921 | Caenorhabditis elegans | adm-4(qy153[adm-4::mNG + LoxP]) X. | Made_by: Eric Hastie|"mNG tag inserted into the endogenous adm-4 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218." | WBGene00000075(adm-4) | WBGene00000075(adm-4) | WB-STRAIN:WBStrain00054921 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:45 | 0 | ||||
|
T19D12.6(qy149[T19D12.6::mNG + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054920 | Caenorhabditis elegans | T19D12.6(qy149[T19D12.6::mNG + LoxP]) II. | mNG tag inserted into the endogenous T19D12.6 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218. | WB-STRAIN:WBStrain00054920 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:45 | 0 | ||||||
|
trak-1(qy158[trak-1::mNG + loxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054927 | Caenorhabditis elegans | trak-1(qy158[trak-1::mNG + loxP]) I. | trak-1 locus endogenously tagged with mNG at the C-terminus. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617 | WBGene00020838(trak-1) | WBGene00020838(trak-1) | WB-STRAIN:WBStrain00054927 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:45 | 0 | ||||
|
qySi569 I; fdgt-1(tm3165) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054928 | Caenorhabditis elegans | qySi569 I; fdgt-1(tm3165) II. | qySi569 [cdh-3p::fdgt-2::mNG + loxP] I. fdgt-1 glucose transporter null mutant expressing a single copy insertion of the glucose transporter fgt-2 in the anchor cell. fdgt-1 and fdgt-2 formerly known as fgt-1 and fgt-2, respectively. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617|"qySi569 [cdh-3p::fgt-2::mNG + loxP] I. fgt-1 glucose transporter null mutant expressing a single copy insertion of the glucose transporter fgt-2 in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617" | WBGene00019207(fdgt-1) | WBGene00019207(fdgt-1) | WB-STRAIN:WBStrain00054928 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:45 | 0 | ||||
|
unc-119(ed3) III; bcSi69 IV; bcEx1368. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054870 | Caenorhabditis elegans | unc-119(ed3) III; bcSi69 IV; bcEx1368. | bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3UTR + Cbr-unc-119(+)] IV. bcEx1368 [U6p::rrn-1(sgRNAs1-4 targeting the rrn-1 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1368 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00054870 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:43 | 0 | ||||
|
ain-1(ku425) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054873 | Caenorhabditis elegans | ain-1(ku425) X. | Made_by: Lei Ding and Kiyokazu Morita|"Superficially wild-type. Identified in a screen for suppressors of the Multivulva (Muv) phenotype in lin-31 loss-of-function (lf) mutants. Reference: Ding L, et al. Mol Cell. 2005 Aug 19;19(4):437-47. PMID: 16109369." | WBGene00015547(ain-1) | WBGene00015547(ain-1) | WB-STRAIN:WBStrain00054873 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:43 | 0 | ||||
|
him-5(e1490) V; etyIs1. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054879 | Caenorhabditis elegans | him-5(e1490) V; etyIs1. | etyIs1 [gpa-13p::FLPase + sra-6p::FRT::mCherry::StopCodon::FRT::GCaMP6s]. Him. Integrated ASH-specific calcium sensor transgene. Reference: Pechuk V., et al. 2022, Current Biology 32, 114. https:|"Made_by: Vladyslava Pechuk"|"Supplementary_genotype etyIs1[Pgpa-13FLPase, Psra-6FTFGCaMP6s]; him-5(e1490)V" | WBGene00001864(him-5) | WBGene00001864(him-5) | WB-STRAIN:WBStrain00054879 | WormBase (WB) | WB | unknown | PMID:37691148 | 2026-08-29 09:28:44 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
