Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00054772

Source Database: WormBase (WB)
Affected Genes: WBGene00010492(meg-1)
Genomic Alteration: WBGene00010492(meg-1)
Availability: unknown
Source References: EMPTY
Synonyms: meg-1(ax4534[meg-1::gfp]) X.
Notes: GFP tag inserted at C-terminus of the endogenous meg-1 locus by CRISPR. Reference: Cassani M & Seydoux G. Development 2022 Nov 1;149(21):dev200920. doi: 10.1242/dev.200920. PMID: 36196602.

Proper citation: RRID:WB-STRAIN:WBStrain00054772 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054774

Source Database: WormBase (WB)
Affected Genes: WBGene00001569(meg-3)|WBGene00003916(par-1)
Genomic Alteration: WBGene00001569(meg-3), WBGene00003916(par-1)
Availability: unknown
Source References: EMPTY
Synonyms: par-1(ax4202[par-1(T983A)]) V/nT1[qIs51] (IV;V); meg-3(ax3054[meg-3::meGFP]) X.
Notes: meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay dead embryos), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Replacement of threonine 983 with alanine eliminates PAR-1 asymmetry. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118

Proper citation: RRID:WB-STRAIN:WBStrain00054774 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054770

Source Database: WormBase (WB)
Affected Genes: WBGene00000265(brd-1)|WBGene00002027(hsr-9)
Genomic Alteration: WBGene00000265(brd-1), WBGene00002027(hsr-9)
Availability: unknown
Source References: EMPTY
Synonyms: hsr-9(xoe17) I; brd-1(xoe18) III.
Notes: Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Proper citation: RRID:WB-STRAIN:WBStrain00054770 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054775

Source Database: WormBase (WB)
Affected Genes: WBGene00001569(meg-3)|WBGene00003916(par-1)
Genomic Alteration: WBGene00001569(meg-3), WBGene00003916(par-1)
Availability: unknown
Source References: EMPTY
Synonyms: par-1(ax4208[meGFP::delta-KA1]) V/nT1[qIs51] (IV;V).
Notes: meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay viable progeny that are completely sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. par-1(ax4208) removes the KA1 domain from a GFP-tagged version of PAR-1. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118

Proper citation: RRID:WB-STRAIN:WBStrain00054775 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054778

Source Database: WormBase (WB)
Affected Genes: WBGene00003800(npp-14)
Genomic Alteration: WBGene00003800(npp-14)
Availability: unknown
Source References: PMID:37254647
Synonyms: npp-14(ax4543) I.
Notes: ax4523 is a deletion residues 24-1387 of the npp-14 coding region. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans

Proper citation: RRID:WB-STRAIN:WBStrain00054778 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054811

Source Database: WormBase (WB)
Affected Genes: WBGene00000168(apx-1)
Genomic Alteration: WBGene00000168(apx-1)
Availability: unknown
Source References: EMPTY
Synonyms: apx-1(q1148[apx-1::3xV5]) V.
Notes: 3xV5 tag inserted at C-terminus of endogenous apx-1 locus. APX-1 guide: GACTCGTCATCTGCTGCCATCGG. APX-1 3xV5 repair with mutation (197 nt): CCTATGGCAGCAGATGACGAGTCGTCGTTTCGAGTCGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTAGATAGTACTGGAAAGCCAATCCCAAACCCACTCCTCGGACTTGATAGCACCGGTAAGCCTATCCCTAACCCACTCCTCGGACTTGATAGCACCTAAACAACAGCTCGACGACGAGATTTACAATAATT.|"CRISPR/Cas9 gene editing was used to insert a 3xV5 tag inserted at the C-terminus of the endogenous apx-1 locus immediately upstream of STOP codon. Animals are fertile and express low levels of APX-1 V5 in adult DTCs."

Proper citation: RRID:WB-STRAIN:WBStrain00054811 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054810

Source Database: WormBase (WB)
Affected Genes: WBGene00003785(nos-3)
Genomic Alteration: WBGene00003785(nos-3)
Availability: unknown
Source References: EMPTY
Synonyms: nos-3(q902) II; qSi380 IV.
Notes: Made_by: Jon Doenier|"qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3'UTR::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem-loops in its 3'UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The GFP reporter RNA has three functional boxB stem-loops in its 3'UTR; the mCherry reporter 3'UTR has three mutated boxB stem-loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224."

Proper citation: RRID:WB-STRAIN:WBStrain00054810 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054819

Source Database: WormBase (WB)
Affected Genes: WBGene00018921(sago-2)
Genomic Alteration: WBGene00018921(sago-2)
Availability: unknown
Source References: EMPTY
Synonyms: sago-2(tor135) I.
Notes: Null allele of sago-2; detectable by PCR/restriction digest. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00054819 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054881

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed9) III; irSi24 IV.
Notes: irSi24 [pept-1::mCherry::H2B + Cbr-unc-119(+)] IV. Single-copy MosSCI insertion of pept-1 reporter into cxTi10882 site in LG IV. mCherry fluorescence exclusively in intestinal nuclei from the end of embryonic development through adulthood. Generated in N2 background. Reference: Maduro MF, et al. Dev Biol 2015 Aug 1;404(1):66-79. doi: 10.1016/j.ydbio.2015.04.025, PMID:25959238.

Proper citation: RRID:WB-STRAIN:WBStrain00054881 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054880

Source Database: WormBase (WB)
Affected Genes: WBGene00006925(vit-1)|WBGene00006926(vit-2)
Genomic Alteration: WBGene00006925(vit-1), WBGene00006926(vit-2)
Availability: unknown
Source References: EMPTY
Synonyms: vit-2(ok3211) vit-1(hq532) X.
Notes: hq532 is a CRISPR-engineered knockout of vit-1 in vit-2(ok3211) background removing 8 bp from the third exon of vit-1: WT sequence AAAGCATTGAGAAGGAGTCCACAACTGTTGTCCGCGGACGCCGTATCCAAACCGGAATCACG mutated to AAAGCATTGAGAAGGAGTCCACAAC--------GCGGACGCCGTATCCAAACCGGAATCACG. For genotyping, the following primers will produce ~800 bp DNA fragment that can be sequenced. Forward primer: TACCAACGTGTTGCTATCGTTTGCTC. Reverse primer: TTGCTCGAAGAGTGGGGTGAACATTCTC. Strain does not express vit-1 or vit-2. Reference: Zhai C, et al. bioRxiv 2022.06.27.497668; doi: https:|"Made_by: Chao Zhai"

Proper citation: RRID:WB-STRAIN:WBStrain00054880 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054925

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: qySi566 I.
Notes: qySi566 [lin-29p::enol-1a::mNG + loxP] I. Single-copy insertion. Anchor cell specific expression of glycolytic enzyme enol-1a which forms puncta at the invasive side and is also expressed in the nucleus. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

Proper citation: RRID:WB-STRAIN:WBStrain00054925 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054924

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: qySi565 I.
Notes: qySi565 [lin-29p::pyk-1a::mNG + loxP] I. Single-copy insertion. Anchor cell-specific expression of the mNG-tagged glycolytic enzyme PYK-1A forms puncta at the site of invasion. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

Proper citation: RRID:WB-STRAIN:WBStrain00054924 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054885

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs181 III; otIs138 X; otIs396.
Notes: Made_by: Barbara OBrien in the Miller lab|"otIs181[dat-1::mCherry + ttx-3::mCherry] III. otIs138[ser-2(prom3)::GFP + rol-6(su1006)] X. otIs396 [ace-1prom2::NLS::tagRFP]. Rollers. dat-1::mCherry labels ADE, CEP, and PDE neurons. ttx3::mCherry labels AIY neurons. ser-2(prom3)::GFP labels OLL, PDE, and PVD neurons. ace-1prom2::NLS::tagRFP labels CEP and OLL neurons. PVD can be identified by expression only GFP. An additional pair of GFP-only cells anterior to OLL are occasionally observed in this strain. Can be used to isolate PVD by FACS (green-only). Used by CeNGEN project for RNA-Seq (https:"

Proper citation: RRID:WB-STRAIN:WBStrain00054885 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054921

Source Database: WormBase (WB)
Affected Genes: WBGene00000075(adm-4)
Genomic Alteration: WBGene00000075(adm-4)
Availability: unknown
Source References: EMPTY
Synonyms: adm-4(qy153[adm-4::mNG + LoxP]) X.
Notes: Made_by: Eric Hastie|"mNG tag inserted into the endogenous adm-4 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218."

Proper citation: RRID:WB-STRAIN:WBStrain00054921 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054920

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: T19D12.6(qy149[T19D12.6::mNG + LoxP]) II.
Notes: mNG tag inserted into the endogenous T19D12.6 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.

Proper citation: RRID:WB-STRAIN:WBStrain00054920 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054927

Source Database: WormBase (WB)
Affected Genes: WBGene00020838(trak-1)
Genomic Alteration: WBGene00020838(trak-1)
Availability: unknown
Source References: EMPTY
Synonyms: trak-1(qy158[trak-1::mNG + loxP]) I.
Notes: trak-1 locus endogenously tagged with mNG at the C-terminus. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

Proper citation: RRID:WB-STRAIN:WBStrain00054927 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054928

Source Database: WormBase (WB)
Affected Genes: WBGene00019207(fdgt-1)
Genomic Alteration: WBGene00019207(fdgt-1)
Availability: unknown
Source References: EMPTY
Synonyms: qySi569 I; fdgt-1(tm3165) II.
Notes: qySi569 [cdh-3p::fdgt-2::mNG + loxP] I. fdgt-1 glucose transporter null mutant expressing a single copy insertion of the glucose transporter fgt-2 in the anchor cell. fdgt-1 and fdgt-2 formerly known as fgt-1 and fgt-2, respectively. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617|"qySi569 [cdh-3p::fgt-2::mNG + loxP] I. fgt-1 glucose transporter null mutant expressing a single copy insertion of the glucose transporter fgt-2 in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617"

Proper citation: RRID:WB-STRAIN:WBStrain00054928 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054870

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; bcSi69 IV; bcEx1368.
Notes: bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3UTR + Cbr-unc-119(+)] IV. bcEx1368 [U6p::rrn-1(sgRNAs1-4 targeting the rrn-1 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1368 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.

Proper citation: RRID:WB-STRAIN:WBStrain00054870 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054873

Source Database: WormBase (WB)
Affected Genes: WBGene00015547(ain-1)
Genomic Alteration: WBGene00015547(ain-1)
Availability: unknown
Source References: EMPTY
Synonyms: ain-1(ku425) X.
Notes: Made_by: Lei Ding and Kiyokazu Morita|"Superficially wild-type. Identified in a screen for suppressors of the Multivulva (Muv) phenotype in lin-31 loss-of-function (lf) mutants. Reference: Ding L, et al. Mol Cell. 2005 Aug 19;19(4):437-47. PMID: 16109369."

Proper citation: RRID:WB-STRAIN:WBStrain00054873 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054879

Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)
Genomic Alteration: WBGene00001864(him-5)
Availability: unknown
Source References: PMID:37691148
Synonyms: him-5(e1490) V; etyIs1.
Notes: etyIs1 [gpa-13p::FLPase + sra-6p::FRT::mCherry::StopCodon::FRT::GCaMP6s]. Him. Integrated ASH-specific calcium sensor transgene. Reference: Pechuk V., et al. 2022, Current Biology 32, 114. https:|"Made_by: Vladyslava Pechuk"|"Supplementary_genotype etyIs1[Pgpa-13FLPase, Psra-6FTFGCaMP6s]; him-5(e1490)V"

Proper citation: RRID:WB-STRAIN:WBStrain00054879 Copy   

•   Source: Integrated Animals