Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407445919
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Live Animals (as of 2024-08-22)
Alternate IDs: 407445919
Notes: The outbred Wistar rats which bred and housed at the Military Medical Academy in Belgrade, Serbia Department for Breeding of Laboratory and Experimental Animals, Institute for Medical Research, Military Medical Academy, Belgrade
Proper citation: RRID:RGD_407445919 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407450413
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 407450413
Notes: The Il6 knockout (KO) rats were generated using the CRISPR/Cas9 technique to induce a shift in the
reading frame of the second exon of Il6 by KAC Co. Ltd (Kyoto, Japan). This strain carried a
118 bp deleted in the second exon of IL-6 National Cerebral and Cardiovascular Center Research Institute, Suita, Osaka 564-8565, Japan
Proper citation: RRID:RGD_407450413 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598154602
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-04-30)
Alternate IDs: 598154602
Notes: Oprk1-cre rats were generated by Dr. Hiroko Tsukamura, Dr. Yoshihisa Uenoyama, Dr. Naoko Inoue, Dr. Mayuko Nagae (Nagoya University) and Dr. Masumi Hirabayashi (National Institute for Physiological Sciences). The CRISPR/Cas9 and adeno-associated virus vector (Oprk1 [exon 4], T2A, Cre) were introduced into the pronuclear stage embryos of Wistar rats (Crlj:WI). It was maintained by mating with the Wistar-Imamichi rats (Iar:WIC) (RGD:125097496) or by sibling mating. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598154602 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598154604
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-04-30)
Alternate IDs: 598154604
Notes: "This knock-in rat was generated by injecting guide RNA, Cas9 protein, and ssODN targeting the Lcn2 gene into fertilized eggs of ZFDM rats. The Lcn2 gene of ZFDM rats has a nonsense mutation (c.409C>T, p.Gln137X), but in this line, this mutation is replaced with the wild type sequence by homologous recombination with the introduced ssODN. The target sequence of the guide RNA is TGACTACGACTAGTTTGCCA. The ssODN sequence for inducing homologous recombination is AAGTGGCCGACACTGACTACGACCAGTTTGCCATGGTATTTTTCCAGAAGACCTCTGAAA.
" National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598154604 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401976372
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 401976372
Notes: CRISPR/Cas9 technology was used to insert an IRES for Cre expression after the corticotropin-releasing hormone (Crh) gene and is expressed in cells that produce CRH.
Proper citation: RRID:RGD_401976372 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616362805
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 616362805
Notes: The bidirectional breeding program of sP (Sardinian alcohol-preferring rats) and sNP (Sardinian non-alcohol-preferring) was begun in 1981 by Drs Fabio Fadda and Gian Luigi
Gessa, at the University of Cagliari, Italy.Selection of sP
and sNP rats started from a heterogeneous base population
of outbred Wistar rats purchased from Morini, San Polo d’Enza, RE,
Italy). The sP rats have alcohol preference in two-bottle chocice between water and 10% alcohol, while the sNP rats prefer water.
Proper citation: RRID:RGD_616362805 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616362803
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 616362803
Notes: The bidirectional breeding program of sP (Sardinian alcohol-preferring rats) and sNP (Sardinian non-alcohol-preferring) was begun in 1981 by Drs Fabio Fadda and Gian Luigi
Gessa, at the University of Cagliari, Italy.Selection of sP
and sNP rats started from a heterogeneous base population
of outbred Wistar rats purchased from Morini, San Polo d’Enza, RE,
Italy). The sP rats have alcohol preference in two-bottle chocice between water and 10% alcohol, while the sNP rats prefer water.
Proper citation: RRID:RGD_616362803 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=630350554
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2026-01-15)
Alternate IDs: 630350554
Notes: A deletion mutation was induced using CRISPR/Cas9 system in embryos of Spague-Dawley rats from Charles River. This strain has been deposited with the RRRC
Proper citation: RRID:RGD_630350554 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629006641
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 629006641
Notes: CRISPR/Cas9 system was used to generate rats with a deletion of the CRE site (Del_TGACGTCA) in the Per1
gene promoter Per1 gene in Sprague Dawley (Charles River) rat embryos. National Institute on Drug Dependence and Beijing Key Laboratory on Drug Dependence Research, Peking University, Beijing, China
Proper citation: RRID:RGD_629006641 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=630350551
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2026-01-14)
Alternate IDs: 630350551
Notes: The CRISPR/Cas9 system was used to delete the entire C17h6orf52 gene from LH/MavRrrcAek embryos. Deletion ranges on chromosome 17 from 23968511 to 23982103 in GRCr8 per NCBI blast - see attachment for sequence annotation. Currently live colony with Dr. Anne Kwitek at the Medical College of Wisconsin. Being cryopreserved and the live colony will not be available.
Proper citation: RRID:RGD_630350551 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=630350396
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 630350396
Notes: Deletion of exons 45 to 47 of the rat Dmd gene by CRISPR/Cas9 was performed by using two pairs of sgRNAs on both sides of exons 45 and 47. The spCas9 and sgRNAs were electroporated in rat Sprague Dawley (RjHan:SD) fertilized oocytes. Genotyping PCR and sequencing were used to confirm the deletion of exons 45–47 in F0 founder animals. Rats can be obtained through material transfer agreement by contacting the corresponding author at valentina.-
[email protected] and [email protected].
Proper citation: RRID:RGD_630350396 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=404976869
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2024-03-18)
Alternate IDs: 404976869
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Tlr4 gene of Crl:SD rat embryos. The resulting mutation is a 14-bp deletion in exon 2; rn7:chr5:80,151,447-80,151,460. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_404976869 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=124715482
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 124715482
Notes: Generated by pronuclear injection of a CRISPR plasmid expressing Cas9 and single-guide RNA targeting the sequence CACTCAGCTTGTTCATGTCCTGG (protospacer adjacent motif underlined) into one-cell SS (SS/JrHsdMcwi) rat embryos. This model harbors a 6-bp deletion (mRatBN7.2 chr2:174,841,367-174,841,372) including the p52SHC initiation codon. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_124715482 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=632518356
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 632518356
Notes: DBH-Cre knock-in (KI) rats, developed on the Sprague
Dawley (SD) rat background, were generated using the CRISPR/Cas9
system. In this knock-in model, a gene cassette encod-
ing 2A peptide, fused to Cre recombinase was introduced to
replace the TAA stop codon in exon 12 of the rat Dbh gene. Additionally, a
synonymous mutation p. T616= (ACG to ACA) was incorporated to pre-
vent gRNA binding and recutting of the sequence following
homology-directed repair. The gRNA targeting the rat DBH gene
(gRNA-B1: 5′-TTACTCAGTGTCTGCCTCCGTGG-3′), the donor vector con-
taining the “P2A-Cre” cassette, and a synonymous mutation p. T616=
(ACG to ACA), along with Cas9 mRNA, were co-injected into fertilized rat embryos. F0 founders. DBH-Cre KI rats were bred with wild-type SD rats (Guangdong Vital River Laboratory Animal Technology Co., Ltd.,
China). Shenzhen Institute of Advanced Technolog, Shenzhen, China
Proper citation: RRID:RGD_632518356 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=152985692
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2022-06-08)
Alternate IDs: 152985692
Notes: CRISPR/Cas9 mutagenesis was used to knockout Cd247 in the WAG/RijCmcr (WAG) strain. A single guide RNA (sgRNA) targeting the Cd247 exon 2 sequence GATGGAATCCTCTTCATCTACGG (protospacer adjacent motif in bold) was injected along with SpCas9 protein into one-cell WAG embryos. A founder offspring harboring a 17-bp frame-shift indel mutation deleting GAATCCTCTTCATCTAC (rn6.0 chr13:84,064,185-84,064,201) was identified and confirmed by Sanger sequencing. The frameshift mutation is predicted to cause a premature truncation of the normal 165 amino acid protein coding sequence after only 37 amino acids, lacking most of the transmembrane and the entirety of the external cellular protein domains. Contact MCW rat distribution at [email protected].
Proper citation: RRID:RGD_152985692 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631721277
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 631721277
Notes: The mutant rats were generated using CRISPR/Cas9 technology to target upstream of exon 11 or downstream of exon 21 of rat Shank3. The resulting mutant carried approximately 26 kb deletions with the removal of the Shank3 exon 11–21 [email protected] at Department of Neurobiology, School of Basic Medical Sciences, Peking University, Beijing, China
Proper citation: RRID:RGD_631721277 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=152998995
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2022-07-15)
Alternate IDs: 152998995
Notes: This model was generated at the Medical College of Wisconsin by CRISPR/Cas9 in Crl:SD strain. The resulting mutation is a 16-bp deletion in the third exon of Ager. rn6.0:chr20:4,150,397-4,150,412. contact MCW Rat Distribution at [email protected]
Proper citation: RRID:RGD_152998995 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629142769
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 629142769
Notes: The is the wild type litter mate for the Dmd mutant: CD-Dmdem1Gene (RGD:629142768), Genethon; 1, bis rue de l’internationale23
91000 Evry, France
Proper citation: RRID:RGD_629142769 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629142768
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 629142768
Notes: The model was generated using a single guide RNA-Cas9 targeted to exon 45 of the rat Dmd gene on a Sprague-Dawley (CD®(SD), Crl:CD(SD)) background. One male founder with a 606 bp deletion encompassing Dmd exon 45 and spanning from 207 bp into the 3’ region of intron 44 to 223 bp into the 5’ region of intron 45,including exon 45, was selected for phenotyping. The heterozygous/hemizygous Dmd knock-out lines were used for breeding. Genethon; 1, bis rue de l’internationale23
91000 Evry, France
Proper citation: RRID:RGD_629142768 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=617301241
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-07-28)
Alternate IDs: 617301241
Notes: Crl:SD embryos were injected with CRISPR-Cas9 using guide RNA targeting the sequence AGGTCATGGATCTTCCAGCC. A 4-bp deletion in exon 2 (rn7: chr5:126,730,986-126,730,989) resulted. Dr. Noreen Rossi, Contact Email: [email protected]
Proper citation: RRID:RGD_617301241 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.