Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: CD19-truncCAR (second generation, intermediate Fc-hinge) CD3z-HDR-template
Vector Backbone Description: Backbone Marker:Twist Bioscience; Backbone Size:2221; Vector Backbone:pTWIST; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:42478045
Comments: This plasmid contains an HDR-template for targeted in-frame knock-in of a truncated CD19-CAR into the human CD3z gene (exon 2) using BEKI (Base-Editor mediated Knock-Ins). This KI-strategy creates an in-frame fusion gene with the endogenous CD3z (CD247) gene, giving rise to expression of a full-length CD19-CAR (Kath et al., 2024, Blood).
The HDR-template is PCR-amplified using the primers: 'BEKI_CD3z_F' atctgctcgccttgtttccac & 'BEKI_CD3z_R' cctctgcctgagtgtaagccc; followed by AMPure bead-purification.
For BEKI (using nCas9-derived base editors), the KI is facilitated by a combination of two Cas9-compatible sgRNAs targeting opposite strands of the genomic DNA. Use the following protospacer sequences: 'Z4': GAATGACACCATAGATGAAG & 'Z7': GAGTGAAGGTGGGTACCACT.
Note: the right homology arm contains 2 PAM-inactivating point-mutations to prevent targeting of the HDR-template by the nCas9-derived base editors.
Proper citation: RRID:Addgene_247057 Copy
Species: Homo sapiens
Genetic Insert: CCT8
Vector Backbone Description: Vector Backbone:pcDNA3.1(+)-C-eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The CCT8-pcDNA3.1(+)-N-eGFP construct was purchased from Genscript. Briefly, the gene fragment was synthesized using gene synthesis and cloned into pcDNA3.1(+)-N-eGFP at the BamHI/XhoI sites. Please visit https://doi.org/10.64898/2025.12.03.691809 for bioRxiv preprint.
Proper citation: RRID:Addgene_245884 Copy
Species: Mus musculus
Genetic Insert: Pparg
Vector Backbone Description: Backbone Size:7800; Vector Backbone:pCW57.1puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_252292 Copy
Species: Homo sapiens
Genetic Insert: Bxb1 phage attachment site (attP) = vector attachment site (attV), CD19-CAR
Vector Backbone Description: Backbone Size:1846; Vector Backbone:truncated pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is PL#1 from our ‘one-pot’ PASTA publication. This integration-plasmid enables expression of a CD19-CAR through Bxb1-mediated in-frame insertion into any translated exon of a transcriptionally active gene (in suitable cell types such as primary human T cells). It is intended for use together with eeBxb1 mRNA, which can be generated by IVT from David Liu’s Addgene plasmid #222339. For TRAC integration, generate HDR-template from plasmid ‘PASTA-1_pUC19_HDR-Bxb1-attG_TRAC_for-Cas12a’ (Addgene #247037), for Cas12a-assisted HDR-mediated TRAC integration of the corresponding Bxb1 landing pad (attB = attG). Please visit https://doi.org/10.1101/2025.09.10.675267 for bioRxiv preprint.
Proper citation: RRID:Addgene_247038 Copy
Species: Homo sapiens
Genetic Insert: Pa01 bacterial attachment site (attB) = genomic attachment site (attG), flanked by human TRAC homology arms
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:; Bacterial Resistance:Ampicillin
Comments: This HDR-template encoding plasmid can be used together with ePa01 mRNA, which can be generated by IVT from our Addgene plasmid #247041 ('PASTA-5_pUC19_IVT-ePa01'). It enables targeted, (e)Pa01-mediated insertion of our integration-plasmid ‘PASTA-4_pUC19_INT-Pa01-attV_P2A_CD19CAR_bGH-pA’ (Addgene plasmid #247040, provided alongside) into the human TRAC gene. Please visit https://doi.org/10.1101/2025.09.10.675267 for bioRxiv preprint.
Proper citation: RRID:Addgene_247039 Copy
Species: Homo sapiens
Genetic Insert: Pa01 phage attachment site (attP) = vector attachment site (attV), CD19-CAR
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid resembles PL#1 from our ‘one-pot’ PASTA publication, but utilizes a Pa01 (attP = attV) docking site. This integration-plasmid enables expression of a CD19-CAR through (e)Pa01-mediated in-frame insertion into any translated exon of a transcriptionally active gene (in suitable cell types such as primary human T cells). It is intended for use together with ePa01 mRNA, which can be generated by IVT from our Addgene plasmid #247041 ('PASTA-5_pUC19_IVT-ePa01'). For TRAC integration, generate HDR-template from plasmid ‘PASTA-3_pUC19_HDR-Pa01-attG_TRAC_for-Cas12a’ (Addgene #247039), for Cas12a-assisted HDR-mediated TRAC integration of the corresponding Pa01 landing pad (attB = attG).
A nt discrepancy was found lacZ-alpha that does not affect plasmid function. Please visit https://doi.org/10.1101/2025.09.10.675267 for bioRxiv preprint.
Proper citation: RRID:Addgene_247040 Copy
Species: Homo sapiens
Genetic Insert: 6xHis-TEV-mCerulean-HsGABARAPL2 (1-116)
Vector Backbone Description: Vector Backbone:pOPTH; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:42693081
Proper citation: RRID:Addgene_252678 Copy
Species: Homo sapiens
Genetic Insert: mCherry-Beclin1
Vector Backbone Description: Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:42693081
Proper citation: RRID:Addgene_252672 Copy
Species: Homo sapiens
Genetic Insert: 6xHis-TEV-mCerulean-HsLC3B (1-120)
Vector Backbone Description: Vector Backbone:pOPTH; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:42693081
Proper citation: RRID:Addgene_252674 Copy
Species: Homo sapiens
Genetic Insert: 6xHis-TEV-mCerulean-HsGABARAP (1-116)
Vector Backbone Description: Vector Backbone:pOPTH; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:42693081
Proper citation: RRID:Addgene_252676 Copy
Species: Homo sapiens
Genetic Insert: 6xHis-TEV-mCerulean-HsGABARAPL1 (1-116)
Vector Backbone Description: Vector Backbone:pOPTH; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:42693081
Proper citation: RRID:Addgene_252677 Copy
Species: Caenorhabditis elegans
Genetic Insert: FRT-SA-C' linker-SL2-tTA(tet-OFF,DBD)-linker-QFAD-stop(TAA)-SEC(pDD364)-N' linker-rFRT3
Vector Backbone Description: Vector Backbone:pFH127; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_255935 Copy
Species: Homo sapiens
Genetic Insert: 6xHis-TEV-mCerulean-GABARAP_L117C
Vector Backbone Description: Vector Backbone:pOPTH; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:42693081
Proper citation: RRID:Addgene_252703 Copy
Species: Caenorhabditis elegans
Genetic Insert: FRT-SA-C' linker-SL2-LexA(DBD)-linker-QFAD-stop(TAA)-SEC(pDD364)-N' linker-rFRT3
Vector Backbone Description: Vector Backbone:pFH127; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_255936 Copy
Species: Caenorhabditis elegans
Genetic Insert: FRT-SA-C' linker-GFP-SEC(pDD363)- N' linker-stop-rFRT3
Vector Backbone Description: Vector Backbone:pFH128; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_255939 Copy
Species: Caenorhabditis elegans
Genetic Insert: FRT-SA-C' linker-SL2-QF2(DBD)-stop(TAA)-SEC(pDD364)-N' linker-rFRT3
Vector Backbone Description: Vector Backbone:pFH127; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_255938 Copy
Species: Caenorhabditis elegans
Genetic Insert: SL2-ATG-rSapI-SpeI-SapI-AAG-SEC(pDD364 with Lox511I)-GGT
Vector Backbone Description: Vector Backbone:pFH127; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_255980 Copy
Species: Synthetic
Genetic Insert: pegRNA: COPG1, insert mNG11
Vector Backbone Description: Vector Backbone:pSB-pegRNA-acceptor-Puro; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39345511
Comments: Please visit https://doi.org/10.1101/2024.09.16.613361 for bioRxiv preprint.
Proper citation: RRID:Addgene_253560 Copy
Species: Synthetic
Genetic Insert: pegRNA: ESYT1 insert mNG11
Vector Backbone Description: Vector Backbone:pSB-pegRNA-acceptor-Puro; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39345511
Comments: Please visit https://doi.org/10.1101/2024.09.16.613361 for bioRxiv preprint.
Proper citation: RRID:Addgene_253561 Copy
Species: Caenorhabditis elegans
Genetic Insert: AAG-SEC(pDD382 with Lox2272)-GGT-rSapI-SpeI-SapI-ACG
Vector Backbone Description: Vector Backbone:pFH173; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_255982 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
