Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
DH10B-M.XmnI Resource Report Resource Website |
RRID:Addgene_114269 | Bleocin (Zeocin) | PMID:29986052 | See Supplemental Documents for strain verification protocols and data. | Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:02:21 | 0 | |||
|
DH10B-M2.NmeMC58II Resource Report Resource Website |
RRID:Addgene_114268 | Bleocin (Zeocin) | PMID:29986052 | See Supplemental Documents for strain verification protocols and data. | Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:02:21 | 0 | |||
|
pfwB Resource Report Resource Website 1+ mentions |
RRID:Addgene_37329 | GFP | Aequorea victoria | Bleocin (Zeocin) | PMID:15709003 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:14:14 | 4 | ||
|
pSV HA eIF2beta (Pro110-113) Resource Report Resource Website |
RRID:Addgene_45899 | eIF2beta | Mus musculus | Bleocin (Zeocin) | PMID:11959995 | Two fragments were PCR amplified from GST-eIF2beta (Addgene plasmid 45900) and ligated together with vector to incorporate deletion. Xba1 site is used to ligate the 2 parts of eIF2beta. | Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pZeoSV2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | P110A, P113A | 2026-08-15 01:15:27 | 0 |
|
pCAG-p21_T145A/S146A Resource Report Resource Website |
RRID:Addgene_42623 | p21 | Homo sapiens | Bleocin (Zeocin) | PMID:23299246 | Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | T145A/S146A | 2026-08-15 01:14:55 | 0 | |
|
pCAG-p21_S146A Resource Report Resource Website |
RRID:Addgene_40205 | p21 | Homo sapiens | Bleocin (Zeocin) | PMID:23299246 | Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | S146A | 2026-08-15 01:14:34 | 0 | |
|
M-tdTom-SP Resource Report Resource Website 1+ mentions |
RRID:Addgene_48677 | TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9 | Synthetic | Bleocin (Zeocin) | PMID:24076762 | Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:15:53 | 2 | ||
|
C321.ΔA.exp Resource Report Resource Website 10+ mentions |
RRID:Addgene_49018 | Recoded E. coli with all UAG codons and RF1 removed (UAG termination abolished); decreased mutation rate; 37C growth tolerated | E. coli | Bleocin (Zeocin) | PMID:24136966 | E. coli MG1655 Delta(ybhB-bioAB)::zeoR Delta prfA; all 321 UAG codons changed to UAA This strain is mutS+, which causes a normal spontaneous mutation frequency of ~1E-10. This strain is auxotrophic for d-biotin. The genome sequence of a similar strain (C321.deltaA) was deposited at NCBI (accession # CP006698.1). | Vector Backbone:E. coli genome; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin) | See genbank file | 2026-08-15 01:15:55 | 31 |
|
p8RwB Resource Report Resource Website 1+ mentions |
RRID:Addgene_48733 | dsRed-Express | Discosoma sp | Bleocin (Zeocin) | PMID:17603495 | This plasmid is nearly identical to pRwB (http://www.addgene.org/48734), except that it contains a 2kb stuffer region to bring its size closer to the ~8kb native papillomavirus genome. For more information on using this plasmid, please see the following website: http://home.ccr.cancer.gov/Lco/target.htm | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:15:53 | 2 | |
|
pRwB Resource Report Resource Website 1+ mentions |
RRID:Addgene_48734 | dsRed-Express | Discosoma sp | Bleocin (Zeocin) | PMID:19073722 | Note that this plasmid is substantially smaller than the ~8kb native papillomavirus genome. There is a second version of this plasmid with a 2kb stuffer region that is available here: http://www.addgene.org/48733 . Further information can be found here: http://home.ccr.cancer.gov/Lco/target.htm | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:15:53 | 1 | |
|
pExpreS2-1 Resource Report Resource Website |
RRID:Addgene_175360 | Bleocin (Zeocin) | PMID:35600892 | This plasmid is designed for use with the ExpreS2 Platform from ExpreS2ion Biotechnologies. It is intended to be used with the ExpreS2ion cells and media which can be obtained directly from the ExpreS2ion website. | Backbone Marker:ExpreS2ion Biotechnologies; Backbone Size:2549; Vector Backbone:pExpreS2-1; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:10:49 | 0 | |||
|
pExpreS2-1-CR-PA-10H-SIII Resource Report Resource Website |
RRID:Addgene_175447 | Bleocin (Zeocin) | PMID:35600892 | This plasmid is designed for use with the ExpreS2 Platform from ExpreS2ion Biotechnologies. It is intended to be used with the ExpreS2ion cells and media which can be obtained directly from the ExpreS2ion website. | Backbone Marker:ExpreS2ion Biotechnologies; Backbone Size:3156; Vector Backbone:pExpreS2-1; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:10:50 | 0 | |||
|
pExpreS2-1-C3-10H-SIII Resource Report Resource Website |
RRID:Addgene_175444 | Bleocin (Zeocin) | PMID:35600892 | This plasmid is designed for use with the ExpreS2 Platform from ExpreS2ion Biotechnologies. It is intended to be used with the ExpreS2ion cells and media which can be obtained directly from the ExpreS2ion website. | Backbone Marker:ExpreS2ion Biotechnologies; Backbone Size:2763; Vector Backbone:pExpreS2-1; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:10:50 | 0 | |||
|
pExpreS2-1-C3-PA Resource Report Resource Website |
RRID:Addgene_175446 | Bleocin (Zeocin) | PMID:35600892 | This plasmid is designed for use with the ExpreS2 Platform from ExpreS2ion Biotechnologies. It is intended to be used with the ExpreS2ion cells and media which can be obtained directly from the ExpreS2ion website. | Backbone Marker:ExpreS2ion Biotechnologies; Backbone Size:3156; Vector Backbone:pExpreS2-1; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:10:50 | 0 | |||
|
SuExp His-Myc-hPLD4 Resource Report Resource Website |
RRID:Addgene_173852 | PLD4 | Homo sapiens | Bleocin (Zeocin) | PMID:34620855 | Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | intracellular and transmembrane domain truncated, with only extracellular domain | 2026-08-15 01:10:35 | 0 | |
|
SuExp His-Myc-hPLD3 Resource Report Resource Website |
RRID:Addgene_173851 | PLD3 | Homo sapiens | Bleocin (Zeocin) | PMID:34620855 | Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | intracellular and transmembrane domain truncated, with only extracellular domain | 2026-08-15 01:10:35 | 0 | |
|
pLenti CMV GFP Zeo (637-7) Resource Report Resource Website 10+ mentions |
RRID:Addgene_17449 | GFP | Bleocin (Zeocin) | PMID:19657394 | Backbone Size:5728; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:10:40 | 11 | |||
|
p221z-CAS9p-TagRFP-t35s Resource Report Resource Website 1+ mentions |
RRID:Addgene_118386 | CAS9p-TagRFP | Other | Bleocin (Zeocin) | PMID:32601420 | Vector Backbone:pDONR-221z; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:03:03 | 1 | ||
|
p221z-CAS9p-t35s Resource Report Resource Website |
RRID:Addgene_118385 | CAS9p | Other | Bleocin (Zeocin) | PMID:32601420 | Vector Backbone:pDONR-221z; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:03:03 | 0 | ||
|
AtPIN1 Resource Report Resource Website |
RRID:Addgene_117088 | AtPIN1 | Arabidopsis thaliana | Bleocin (Zeocin) | Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:02:50 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
