Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 99 showing 1961 ~ 1980 out of 739,423 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_23427

http://www.addgene.org/23427

Species: Homo sapiens
Genetic Insert: PGK1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23427 Copy   


  • RRID:Addgene_23428

http://www.addgene.org/23428

Species: Homo sapiens
Genetic Insert: CHKA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23428 Copy   


  • RRID:Addgene_23429

http://www.addgene.org/23429

Species: Homo sapiens
Genetic Insert: CDC2L6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23429 Copy   


  • RRID:Addgene_23386

http://www.addgene.org/23386

Species: Homo sapiens
Genetic Insert: CIB4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23386 Copy   


  • RRID:Addgene_23266

    This resource has 1+ mentions.

http://www.addgene.org/23266

Species: Homo sapiens
Genetic Insert: PLK3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Please note that due to the presence of a 6xHis tag this plasmid appears to encode aa 2-327 for PLK3.

Proper citation: RRID:Addgene_23266 Copy   


  • RRID:Addgene_23420

http://www.addgene.org/23420

Species: Homo sapiens
Genetic Insert: MAPK8
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23420 Copy   


  • RRID:Addgene_23421

    This resource has 1+ mentions.

http://www.addgene.org/23421

Species: Homo sapiens
Genetic Insert: CDKL2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23421 Copy   


  • RRID:Addgene_23268

    This resource has 1+ mentions.

http://www.addgene.org/23268

Species: Homo sapiens
Genetic Insert: PLK3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_23268 Copy   


  • RRID:Addgene_23389

    This resource has 1+ mentions.

http://www.addgene.org/23389

Species: Homo sapiens
Genetic Insert: CDKL1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23389 Copy   


  • RRID:Addgene_23422

http://www.addgene.org/23422

Species: Homo sapiens
Genetic Insert: CAMKK2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23422 Copy   


  • RRID:Addgene_23383

http://www.addgene.org/23383

Species: Homo sapiens
Genetic Insert: PRKX
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23383 Copy   


  • RRID:Addgene_23385

http://www.addgene.org/23385

Species: Homo sapiens
Genetic Insert: PHKG1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23385 Copy   


http://www.addgene.org/23260

Species: Homo sapiens
Genetic Insert: poly(ADP-ribose) glycohydrolase shRNA
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: shRNA oligo sequence is - 5'-CCGGGCTGAGCGAGATGTGGTTTATCTCGAGATAAACCACATCTCGCTCAGCTTTTTG

Proper citation: RRID:Addgene_23260 Copy   


  • RRID:Addgene_23358

http://www.addgene.org/23358

Species: Homo sapiens
Genetic Insert: C1orf57
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23358 Copy   


  • RRID:Addgene_23353

http://www.addgene.org/23353

Species: Homo sapiens
Genetic Insert: NME1-NME2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23353 Copy   


  • RRID:Addgene_23354

    This resource has 1+ mentions.

http://www.addgene.org/23354

Species: Homo sapiens
Genetic Insert: CRKL
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23354 Copy   


  • RRID:Addgene_23356

http://www.addgene.org/23356

Species: Homo sapiens
Genetic Insert: CCL4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23356 Copy   


  • RRID:Addgene_23405

http://www.addgene.org/23405

Species: Homo sapiens
Genetic Insert: SNRK
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23405 Copy   


  • RRID:Addgene_23406

    This resource has 1+ mentions.

http://www.addgene.org/23406

Species: Homo sapiens
Genetic Insert: MAP2K1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23406 Copy   


  • RRID:Addgene_23408

    This resource has 1+ mentions.

http://www.addgene.org/23408

Species: Homo sapiens
Genetic Insert: CAMK2A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections. A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.

Proper citation: RRID:Addgene_23408 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X