Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 97 showing 1921 ~ 1940 out of 30,517 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.addgene.org/210734

Species: Synthetic
Genetic Insert: SaSp D10A Cas9
Vector Backbone Description: Backbone Marker:Genscript; Vector Backbone:pUC57 ; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2023.10.24.563270 for bioRxiv preprint.

Proper citation: RRID:Addgene_210734 Copy   

    • RRID:Addgene_224298

http://www.addgene.org/224298

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39946463

Proper citation: RRID:Addgene_224298 Copy   

    • RRID:Addgene_228895

    This resource has 1+ mentions.

http://www.addgene.org/228895

Species: Synthetic
Genetic Insert: GST-tagged Nb32
Vector Backbone Description: Backbone Marker:Twist Bioscience; Backbone Size:5370; Vector Backbone:pET-29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40053481

Proper citation: RRID:Addgene_228895 Copy   

    • RRID:Addgene_160294

http://www.addgene.org/160294

Species: Synthetic
Genetic Insert: sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Vector Backbone Description: Backbone Marker:Jamie Cate; Vector Backbone:pCAS (Addgene #60847); Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29626221

Proper citation: RRID:Addgene_160294 Copy   

    • RRID:Addgene_160296

http://www.addgene.org/160296

Species: Synthetic
Genetic Insert: sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Vector Backbone Description: Backbone Marker:Jamie Cate; Vector Backbone:pCAS (Addgene #60847); Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29626221

Proper citation: RRID:Addgene_160296 Copy   

    • RRID:Addgene_160299

http://www.addgene.org/160299

Species: Synthetic
Genetic Insert: sgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
Vector Backbone Description: Backbone Marker:Jamie Cate; Vector Backbone:pCAS (Addgene #60847); Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29626221

Proper citation: RRID:Addgene_160299 Copy   

http://www.addgene.org/232296

Species: Synthetic
Genetic Insert: Octo_VirD2_NLS-Cas9-6xHis
Vector Backbone Description: Backbone Marker:David Liu; Backbone Size:5140; Vector Backbone:pET-NLS-Cas9-6xHis (Addgene Plasmid #62934); Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40030016

Proper citation: RRID:Addgene_232296 Copy   

http://www.addgene.org/233615

Species: Synthetic
Genetic Insert: Rluc-Y39x-Fluc
Vector Backbone Description: Vector Backbone:psiCHECK2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35674491

Proper citation: RRID:Addgene_233615 Copy   

http://www.addgene.org/220708

Species: Synthetic
Genetic Insert: iCre
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403729
Comments: 5' Cloning Site: MluI (not destroyed), 3' Cloning Site: SgrAI (not destroyed). Please visit https://doi.org/10.1101/2024.06.10.597244 for bioRxiv preprint.

Proper citation: RRID:Addgene_220708 Copy   

http://www.addgene.org/233613

Species: Synthetic
Genetic Insert: gRNA targeting EGFP
Vector Backbone Description: Vector Backbone:pUC016; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38467613

Proper citation: RRID:Addgene_233613 Copy   

http://www.addgene.org/233047

Species: Synthetic
Genetic Insert: GFP and GluN2B
Vector Backbone Description: Vector Backbone:pLenti; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_233047 Copy   

http://www.addgene.org/220722

Species: Synthetic
Genetic Insert: iCre(R297T)
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403729
Comments: 5' Cloning Site: MluI (not destroyed), 3' Cloning Site: SgrAI (not destroyed). Please visit https://doi.org/10.1101/2024.06.10.597244 for bioRxiv preprint.

Proper citation: RRID:Addgene_220722 Copy   

http://www.addgene.org/220728

Species: Synthetic
Genetic Insert: iCre(R297T)
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403729
Comments: 5' Cloning Site: MluI (not destroyed), 3' Cloning Site: SgrAI (not destroyed).

Proper citation: RRID:Addgene_220728 Copy   

http://www.addgene.org/220724

Species: Synthetic
Genetic Insert: iCre(R297T)
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403729
Comments: 5' Cloning Site: MluI (not destroyed), 3' Cloning Site: SgrAI (not destroyed). Please visit https://doi.org/10.1101/2024.06.10.597244 for bioRxiv preprint.

Proper citation: RRID:Addgene_220724 Copy   

http://www.addgene.org/220726

Species: Synthetic
Genetic Insert: iCre(R297T)
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403729
Comments: 5' Cloning Site: MluI (not destroyed), 3' Cloning Site: SgrAI (not destroyed).

Proper citation: RRID:Addgene_220726 Copy   

http://www.addgene.org/220725

Species: Synthetic
Genetic Insert: iCre(R297T)
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403729
Comments: 5' Cloning Site: MluI (not destroyed), 3' Cloning Site: SgrAI (not destroyed). Please visit https://doi.org/10.1101/2024.06.10.597244 for bioRxiv preprint.

Proper citation: RRID:Addgene_220725 Copy   

    • RRID:Addgene_190184

http://www.addgene.org/190184

Species: Synthetic
Genetic Insert: tdiRFP
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:PB510B-1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35798028

Proper citation: RRID:Addgene_190184 Copy   

http://www.addgene.org/220711

Species: Synthetic
Genetic Insert: iCre(R297T)
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403729
Comments: 5' Cloning Site: MluI (not destroyed), 3' Cloning Site: SgrAI (not destroyed). Please visit https://doi.org/10.1101/2024.06.10.597244 for bioRxiv preprint.

Proper citation: RRID:Addgene_220711 Copy   

http://www.addgene.org/220718

Species: Synthetic
Genetic Insert: iCre
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38915722
Comments: 5' Cloning Site: MluI (not destroyed), 3' Cloning Site: SgrAI (not destroyed). Please visit https://doi.org/10.1101/2024.06.10.597244 for bioRxiv preprint.

Proper citation: RRID:Addgene_220718 Copy   

http://www.addgene.org/220713

Species: Synthetic
Genetic Insert: iCre(R297T)
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403729
Comments: 5' Cloning Site: MluI (not destroyed), 3' Cloning Site: SgrAI (not destroyed). Please visit https://doi.org/10.1101/2024.06.10.597244 for bioRxiv preprint.

Proper citation: RRID:Addgene_220713 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch