Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 96 showing 1901 ~ 1920 out of 739,854 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/45944

Species: Aequorea victoria
Genetic Insert: synthetic sfYFP (codon usage adapted to P.putida KT2440)
Vector Backbone Description: Backbone Marker:Dammeyer et al. 2013; Vector Backbone:pTDpelB-CTwinStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23687945
Comments: This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long

Proper citation: RRID:Addgene_45944 Copy   


  • RRID:Addgene_45946

    This resource has 100+ mentions.

http://www.addgene.org/45946

Genetic Insert: U6-BbsI-chiRNA
Vector Backbone Description: Backbone Marker:Agilent; Backbone Size:2958; Vector Backbone:pBS-SK(+); Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23709638
Comments: For more information on FlyCRISPR plasmids please refer to: https://www.addgene.org/browse/article/6834/. Plasmid 51019: pDsRed-attP (www.addgene.org/51019) can be for generating dsDNA donors for homology-directed repair to replace genes or other genomic sequence with an attP docking site. Please note the F1 ori is in the (+) orientation, rather than the (-) orientation shown in the assembled full sequence.

Proper citation: RRID:Addgene_45946 Copy   


  • RRID:Addgene_45940

http://www.addgene.org/45940

Vector Backbone Description: Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23687945
Comments: This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long

Proper citation: RRID:Addgene_45940 Copy   


  • RRID:Addgene_45934

http://www.addgene.org/45934

Species: Homo sapiens
Genetic Insert: Eps-15 homology domain-containing protein2
Vector Backbone Description: Backbone Marker:Clontech/ custom-made; Backbone Size:4745; Vector Backbone:pmEGFP-N-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22505029

Proper citation: RRID:Addgene_45934 Copy   


  • RRID:Addgene_45933

http://www.addgene.org/45933

Species: Homo sapiens
Genetic Insert: Eps-15 homology domain-containing protein2
Vector Backbone Description: Backbone Marker:Clontech/ custom-made; Backbone Size:4736; Vector Backbone:pmEGFP-N-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22505029

Proper citation: RRID:Addgene_45933 Copy   


  • RRID:Addgene_45936

    This resource has 1+ mentions.

http://www.addgene.org/45936

Vector Backbone Description: Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23687945
Comments: This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long

Proper citation: RRID:Addgene_45936 Copy   


  • RRID:Addgene_45935

http://www.addgene.org/45935

Species: Homo sapiens
Genetic Insert: Eps-15 homology domain-containing protein2
Vector Backbone Description: Backbone Marker:Clontech/ custom-made; Backbone Size:4736; Vector Backbone:pmEGFP-N-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22505029

Proper citation: RRID:Addgene_45935 Copy   


  • RRID:Addgene_45937

http://www.addgene.org/45937

Vector Backbone Description: Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23687945
Comments: This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long

Proper citation: RRID:Addgene_45937 Copy   


  • RRID:Addgene_45939

http://www.addgene.org/45939

Vector Backbone Description: Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23687945
Comments: This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long

Proper citation: RRID:Addgene_45939 Copy   


  • RRID:Addgene_46059

http://www.addgene.org/46059

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5336; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.

Proper citation: RRID:Addgene_46059 Copy   


  • RRID:Addgene_46058

    This resource has 1+ mentions.

http://www.addgene.org/46058

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4734; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.

Proper citation: RRID:Addgene_46058 Copy   


  • RRID:Addgene_46051

http://www.addgene.org/46051

Species: Rattus norvegicus
Genetic Insert: Jag1
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pT3-EF1a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23419361
Comments: This plasmid is in the pT3-EF1a vector which contains loxP sites flanking the inverted repeats of SB (sleeping beauty) sequence. Therefore this plasmid cannot not used with Cre for in vivo studies.

Proper citation: RRID:Addgene_46051 Copy   


  • RRID:Addgene_46170

    This resource has 1+ mentions.

http://www.addgene.org/46170

Species: Synthetic
Genetic Insert: klp-12 targeting sgRNA
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: gRNA target sequence GATCCACAAGTTACAATTGG

Proper citation: RRID:Addgene_46170 Copy   


  • RRID:Addgene_46050

    This resource has 1+ mentions.

http://www.addgene.org/46050

Species: Homo sapiens
Genetic Insert: Yes-kinase associated protein
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23419361

Proper citation: RRID:Addgene_46050 Copy   


http://www.addgene.org/46171

Species: Gallus gallus
Genetic Insert: Vcl
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15195105

Proper citation: RRID:Addgene_46171 Copy   


  • RRID:Addgene_46055

    This resource has 1+ mentions.

http://www.addgene.org/46055

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5205; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.

Proper citation: RRID:Addgene_46055 Copy   


  • RRID:Addgene_46056

    This resource has 1+ mentions.

http://www.addgene.org/46056

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4880; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.

Proper citation: RRID:Addgene_46056 Copy   


  • RRID:Addgene_46053

http://www.addgene.org/46053

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5468; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.

Proper citation: RRID:Addgene_46053 Copy   


  • RRID:Addgene_46048

    This resource has 1+ mentions.

http://www.addgene.org/46048

Species: Mus musculus
Genetic Insert: Notch1 (C-term)
Vector Backbone Description: Backbone Marker:Invitrogen ; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22797301

Proper citation: RRID:Addgene_46048 Copy   


  • RRID:Addgene_46169

    This resource has 10+ mentions.

http://www.addgene.org/46169

Species: Synthetic
Genetic Insert: unc-119 targeting sgRNA
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: gRNA target sequence GAATTTTCTGAAATTAAAGA

Proper citation: RRID:Addgene_46169 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X