Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,423 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
Myc-CREST (C88)
 
Resource Report
Resource Website 		RRID:Addgene_22960 CREST Rattus norvegicus Ampicillin Backbone Size:5000; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:37 0
pMX240
 
Resource Report
Resource Website 		RRID:Addgene_23010 GCPBM Cricetulus griseus Kanamycin PMID:18039936 Backbone Size:5205; Vector Backbone:pGFPCPB1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin deleted MCAK amino acids 1-178, 584-718 mutated S186A 2026-07-25 12:44:37 0
pSEL1
 
Resource Report
Resource Website 		RRID:Addgene_23011 DHFR Mus musculus Chloramphenicol PMID:19165721 Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pBAD/HisA & pBThybrid; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-07-25 12:44:37 0
pcDNA FLAG TORC3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22976 TORC3 Homo sapiens Ampicillin PMID:15454081 Backbone Size:5000; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:37 2
T7-p73DD-pcDNA3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22978 tumor protein p73 Homo sapiens Ampicillin PMID:11034215 Backbone Marker:Invitrogen; Backbone Size:5484; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin truncated cDNA encodes truncated protein (aa 327-636) with dominant negative function 2026-07-25 12:44:37 3
pBud-EGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23027 EGFP Bleocin (Zeocin) PMID:19680558 Bigenic vector with EF-1alpha promoter and CMV promoter Backbone Marker:Invitrogen; Backbone Size:4578; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-07-25 12:44:38 6
pCDNA GAL4 CREB 1-341 M1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22973 CREB Rattus norvegicus Ampicillin PMID:12718894 GAL4 DNA-binding domain fused N-terminally to full-length CREB cDNA (aa 4-341) Backbone Size:5000; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Changed Serine 133 to Alanine of CREB 2026-07-25 12:44:37 1
pcDNA FLAG TORC1 (1-630)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22974 TORC1 (1-630) Homo sapiens Ampicillin PMID:14536081 There is an XbaI site at the 3' end instead of a NotI site. Backbone Size:5446; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Amino acids 1-630 rather than 1-634. 2026-07-25 12:44:37 1
Myc tag WT PTB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23024 PTB1 Homo sapiens Ampicillin PMID:12851456 Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:38 3
pDUP 4-1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23022 c-src Mus musculus Ampicillin PMID:9343417 This clone was assembled from multiple PCR products by using the following primers, described by their sequence relationship to the transcribed DUP RNA. DUP1 (GCAGCTCACTCAGTGTGGCA) is complementary to CMV DUP33 exon 3 (globin exon 2). DUP2 (CCAATAGATCTGGGCATGTG) is homolo- gous to CMV DUP33 intron 2 but with an inserted BglII site. DUP3 (CACAT GCCCAGATCTATTGG) is complementary to intron 2 and to primer DUP2 and also contains the BglII site. DUP4 (GCTGCTGGTGGTGCCATGGC) is homologous to CMV DUP33 exon 2. DUP5 (CTGCCCAGGGCCTGCCAT GG) is complementary to CMV DUP33 exon 2 and to primer DUP4. DUP6 (TTCTGATAGGGCCCACTGACTCT) is homologous to CMV DUP33 intron 1 but contains an inserted ApaI site. DUP7 (AGAGTCAGTGGGCCCTATCA GAA) also contains the ApaI site and is complementary to intron 1 and primer DUP6. DUP8 (GACACCATGCATGGTGCACC) is homologous to DUP exon 1. A series of PCRs was performed with the following primers and templates. Fragments of CMV DUP33 DNA were amplified by using primer pairs 1-2, 3-4, 5-6, and 7-8. The second set of PCRs used the following: primers 1 and 4 with the 1-2 and 3-4 PCR products as templates, and primers 5 and 8 with the 5-6 and 7-8 PCR products as templates. A final PCR assembled a complete fragment by using primers 1 and 8 with the 1-4 and 5-8 PCR products as templates. This final PCR product was cleaved with NsiI and DraIII and inserted into the CMV DUP33 vector also cleaved with NsiI and DraIII. This clone was designated DUP4-1. Backbone Marker:Z Dominski and R Kole; Backbone Size:0; Vector Backbone:DUP33; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:38 1
pCI-neo-hApg5-HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22948 Homo sapiens ATG5 autophagy related 5 homolog (S. cerevisiae) Homo sapiens Ampicillin PMID:9852036 Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:37 9
pCI-neo-hApg5(K130R)-HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22949 Homo sapiens ATG5 autophagy related 5 homolog (S. cerevisiae) Homo sapiens Ampicillin PMID:9852036 Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 130 Lysine to Arginine 2026-07-25 12:44:37 3
pLenti6/V5-p53_wt p53
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_22945 tumor protein 53 Homo sapiens Ampicillin PMID:18472962 Backbone Marker:Invitrogen; Backbone Size:6963; Vector Backbone:pLenti6/V5-D-TOPO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:44:37 21
pEGFP-C1-mApg5
 
Resource Report
Resource Website 		RRID:Addgene_22958 autophagy related genes 5 Mus musculus Kanamycin PMID:11266458 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-07-25 12:44:37 0
pCI-neo-mApg5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22956 autophagy related genes 5 Mus musculus Ampicillin PMID:11266458 Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:37 5
pCI-neo-HA-hApg12
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22950 autophagy related genes 12 Homo sapiens Ampicillin PMID:9852036 Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:37 2
pMX234
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23006 mRFP-CenpB Cricetulus griseus Kanamycin PMID:18267093 Backbone Size:4004; Vector Backbone:pCMV-M1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin deleted CenpB amino acids 169-606, T145S 2026-07-25 12:44:37 1
pCMV-M1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23007 Kanamycin PMID:18267093 Backbone Marker:Clontech; Backbone Size:4004; Vector Backbone:pEGPF-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-07-25 12:44:37 5
pMX215
 
Resource Report
Resource Website 		RRID:Addgene_23008 RAMFLhyp Cricetulus griseus Kanamycin PMID:18039936 Backbone Size:4004; Vector Backbone:pCMV-M1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-07-25 12:44:37 0
pEGFPC1-6XHis-FLKSRP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23001 KSRP Homo sapiens Kanamycin PMID:14657238 The KHSRP insert in this plasmid contains an extra amino acid, valine, at position #2. Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin valine inserted at aa#2 2026-07-25 12:44:37 5

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join NIH ODSS Data Sharing and Reuse Seminar "PanKbase: An Open, FAIR Knowledge Base of the Human Pancreas to Accelerate Diabetes Research"

Join the NIDDK-CR Webinar "Design Patterns for Reproducible Research" on July 29, 2026

dkNET Showcases AI-Driven Biomedical Data Science Innovations at ISMB 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch