Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: CREST
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22960 Copy
Species: Cricetulus griseus
Genetic Insert: GCPBM
Vector Backbone Description: Backbone Size:5205; Vector Backbone:pGFPCPB1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_23010 Copy
Species: Mus musculus
Genetic Insert: DHFR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pBAD/HisA & pBThybrid; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
References:
Comments:
Proper citation: RRID:Addgene_23011 Copy
Species: Homo sapiens
Genetic Insert: TORC3
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22976 Copy
Species: Homo sapiens
Genetic Insert: tumor protein p73
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5484; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22978 Copy
Species:
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4578; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: Bigenic vector with EF-1alpha promoter and CMV promoter
Proper citation: RRID:Addgene_23027 Copy
Species: Rattus norvegicus
Genetic Insert: CREB
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: GAL4 DNA-binding domain fused N-terminally to full-length CREB cDNA (aa 4-341)
Proper citation: RRID:Addgene_22973 Copy
Species: Homo sapiens
Genetic Insert: TORC1 (1-630)
Vector Backbone Description: Backbone Size:5446; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: There is an XbaI site at the 3' end instead of a NotI site.
Proper citation: RRID:Addgene_22974 Copy
Species: Homo sapiens
Genetic Insert: PTB1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_23024 Copy
Species: Mus musculus
Genetic Insert: c-src
Vector Backbone Description: Backbone Marker:Z Dominski and R Kole; Backbone Size:0; Vector Backbone:DUP33; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This clone was assembled from multiple PCR products by using the following
primers, described by their sequence relationship to the transcribed DUP RNA.
DUP1 (GCAGCTCACTCAGTGTGGCA) is complementary to CMV DUP33
exon 3 (globin exon 2). DUP2 (CCAATAGATCTGGGCATGTG) is homolo-
gous to CMV DUP33 intron 2 but with an inserted BglII site. DUP3 (CACAT
GCCCAGATCTATTGG) is complementary to intron 2 and to primer DUP2
and also contains the BglII site. DUP4 (GCTGCTGGTGGTGCCATGGC) is
homologous to CMV DUP33 exon 2. DUP5 (CTGCCCAGGGCCTGCCAT
GG) is complementary to CMV DUP33 exon 2 and to primer DUP4. DUP6
(TTCTGATAGGGCCCACTGACTCT) is homologous to CMV DUP33 intron
1 but contains an inserted ApaI site. DUP7 (AGAGTCAGTGGGCCCTATCA
GAA) also contains the ApaI site and is complementary to intron 1 and primer
DUP6. DUP8 (GACACCATGCATGGTGCACC) is homologous to DUP exon
1. A series of PCRs was performed with the following primers and templates.
Fragments of CMV DUP33 DNA were amplified by using primer pairs 1-2, 3-4,
5-6, and 7-8. The second set of PCRs used the following: primers 1 and 4 with the
1-2 and 3-4 PCR products as templates, and primers 5 and 8 with the 5-6 and 7-8
PCR products as templates. A final PCR assembled a complete fragment by
using primers 1 and 8 with the 1-4 and 5-8 PCR products as templates. This final
PCR product was cleaved with NsiI and DraIII and inserted into the CMV
DUP33 vector also cleaved with NsiI and DraIII. This clone was designated
DUP4-1.
Proper citation: RRID:Addgene_23022 Copy
Species: Homo sapiens
Genetic Insert: Homo sapiens ATG5 autophagy related 5 homolog (S. cerevisiae)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22948 Copy
Species: Homo sapiens
Genetic Insert: Homo sapiens ATG5 autophagy related 5 homolog (S. cerevisiae)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22949 Copy
Species: Homo sapiens
Genetic Insert: tumor protein 53
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6963; Vector Backbone:pLenti6/V5-D-TOPO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22945 Copy
Species: Mus musculus
Genetic Insert: autophagy related genes 5
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22958 Copy
Species: Mus musculus
Genetic Insert: autophagy related genes 5
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22956 Copy
Species: Homo sapiens
Genetic Insert: autophagy related genes 12
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22950 Copy
Species: Cricetulus griseus
Genetic Insert: mRFP-CenpB
Vector Backbone Description: Backbone Size:4004; Vector Backbone:pCMV-M1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_23006 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4004; Vector Backbone:pEGPF-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_23007 Copy
Species: Cricetulus griseus
Genetic Insert: RAMFLhyp
Vector Backbone Description: Backbone Size:4004; Vector Backbone:pCMV-M1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_23008 Copy
Species: Homo sapiens
Genetic Insert: KSRP
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: The KHSRP insert in this plasmid contains an extra amino acid, valine, at position #2.
Proper citation: RRID:Addgene_23001 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.