Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 94 showing 1861 ~ 1880 out of 739,423 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_22960

http://www.addgene.org/22960

Species: Rattus norvegicus
Genetic Insert: CREST
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22960 Copy   


  • RRID:Addgene_23010

http://www.addgene.org/23010

Species: Cricetulus griseus
Genetic Insert: GCPBM
Vector Backbone Description: Backbone Size:5205; Vector Backbone:pGFPCPB1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_23010 Copy   


  • RRID:Addgene_23011

http://www.addgene.org/23011

Species: Mus musculus
Genetic Insert: DHFR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pBAD/HisA & pBThybrid; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
References:
Comments:

Proper citation: RRID:Addgene_23011 Copy   


  • RRID:Addgene_22976

    This resource has 1+ mentions.

http://www.addgene.org/22976

Species: Homo sapiens
Genetic Insert: TORC3
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22976 Copy   


  • RRID:Addgene_22978

    This resource has 1+ mentions.

http://www.addgene.org/22978

Species: Homo sapiens
Genetic Insert: tumor protein p73
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5484; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22978 Copy   


  • RRID:Addgene_23027

    This resource has 1+ mentions.

http://www.addgene.org/23027

Species:
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4578; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: Bigenic vector with EF-1alpha promoter and CMV promoter

Proper citation: RRID:Addgene_23027 Copy   


  • RRID:Addgene_22973

    This resource has 1+ mentions.

http://www.addgene.org/22973

Species: Rattus norvegicus
Genetic Insert: CREB
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: GAL4 DNA-binding domain fused N-terminally to full-length CREB cDNA (aa 4-341)

Proper citation: RRID:Addgene_22973 Copy   


  • RRID:Addgene_22974

    This resource has 1+ mentions.

http://www.addgene.org/22974

Species: Homo sapiens
Genetic Insert: TORC1 (1-630)
Vector Backbone Description: Backbone Size:5446; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: There is an XbaI site at the 3' end instead of a NotI site.

Proper citation: RRID:Addgene_22974 Copy   


  • RRID:Addgene_23024

    This resource has 1+ mentions.

http://www.addgene.org/23024

Species: Homo sapiens
Genetic Insert: PTB1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_23024 Copy   


  • RRID:Addgene_23022

    This resource has 1+ mentions.

http://www.addgene.org/23022

Species: Mus musculus
Genetic Insert: c-src
Vector Backbone Description: Backbone Marker:Z Dominski and R Kole; Backbone Size:0; Vector Backbone:DUP33; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This clone was assembled from multiple PCR products by using the following primers, described by their sequence relationship to the transcribed DUP RNA. DUP1 (GCAGCTCACTCAGTGTGGCA) is complementary to CMV DUP33 exon 3 (globin exon 2). DUP2 (CCAATAGATCTGGGCATGTG) is homolo- gous to CMV DUP33 intron 2 but with an inserted BglII site. DUP3 (CACAT GCCCAGATCTATTGG) is complementary to intron 2 and to primer DUP2 and also contains the BglII site. DUP4 (GCTGCTGGTGGTGCCATGGC) is homologous to CMV DUP33 exon 2. DUP5 (CTGCCCAGGGCCTGCCAT GG) is complementary to CMV DUP33 exon 2 and to primer DUP4. DUP6 (TTCTGATAGGGCCCACTGACTCT) is homologous to CMV DUP33 intron 1 but contains an inserted ApaI site. DUP7 (AGAGTCAGTGGGCCCTATCA GAA) also contains the ApaI site and is complementary to intron 1 and primer DUP6. DUP8 (GACACCATGCATGGTGCACC) is homologous to DUP exon 1. A series of PCRs was performed with the following primers and templates. Fragments of CMV DUP33 DNA were amplified by using primer pairs 1-2, 3-4, 5-6, and 7-8. The second set of PCRs used the following: primers 1 and 4 with the 1-2 and 3-4 PCR products as templates, and primers 5 and 8 with the 5-6 and 7-8 PCR products as templates. A final PCR assembled a complete fragment by using primers 1 and 8 with the 1-4 and 5-8 PCR products as templates. This final PCR product was cleaved with NsiI and DraIII and inserted into the CMV DUP33 vector also cleaved with NsiI and DraIII. This clone was designated DUP4-1.

Proper citation: RRID:Addgene_23022 Copy   


  • RRID:Addgene_22948

    This resource has 1+ mentions.

http://www.addgene.org/22948

Species: Homo sapiens
Genetic Insert: Homo sapiens ATG5 autophagy related 5 homolog (S. cerevisiae)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22948 Copy   


  • RRID:Addgene_22949

    This resource has 1+ mentions.

http://www.addgene.org/22949

Species: Homo sapiens
Genetic Insert: Homo sapiens ATG5 autophagy related 5 homolog (S. cerevisiae)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22949 Copy   


  • RRID:Addgene_22945

    This resource has 10+ mentions.

http://www.addgene.org/22945

Species: Homo sapiens
Genetic Insert: tumor protein 53
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6963; Vector Backbone:pLenti6/V5-D-TOPO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22945 Copy   


  • RRID:Addgene_22958

http://www.addgene.org/22958

Species: Mus musculus
Genetic Insert: autophagy related genes 5
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_22958 Copy   


  • RRID:Addgene_22956

    This resource has 1+ mentions.

http://www.addgene.org/22956

Species: Mus musculus
Genetic Insert: autophagy related genes 5
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22956 Copy   


  • RRID:Addgene_22950

    This resource has 1+ mentions.

http://www.addgene.org/22950

Species: Homo sapiens
Genetic Insert: autophagy related genes 12
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22950 Copy   


  • RRID:Addgene_23006

    This resource has 1+ mentions.

http://www.addgene.org/23006

Species: Cricetulus griseus
Genetic Insert: mRFP-CenpB
Vector Backbone Description: Backbone Size:4004; Vector Backbone:pCMV-M1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_23006 Copy   


  • RRID:Addgene_23007

    This resource has 1+ mentions.

http://www.addgene.org/23007

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4004; Vector Backbone:pEGPF-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_23007 Copy   


  • RRID:Addgene_23008

http://www.addgene.org/23008

Species: Cricetulus griseus
Genetic Insert: RAMFLhyp
Vector Backbone Description: Backbone Size:4004; Vector Backbone:pCMV-M1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_23008 Copy   


  • RRID:Addgene_23001

    This resource has 1+ mentions.

http://www.addgene.org/23001

Species: Homo sapiens
Genetic Insert: KSRP
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: The KHSRP insert in this plasmid contains an extra amino acid, valine, at position #2.

Proper citation: RRID:Addgene_23001 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X