SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 91 showing 1801 ~ 1820 out of 743,073 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_19787

http://www.addgene.org/19787

Species: Homo sapiens
Genetic Insert: NFRKB
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5700; Vector Backbone:pET19b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18922472

Proper citation: RRID:Addgene_19787 Copy   


http://www.addgene.org/19820

Genetic Insert: miRNA
Vector Backbone Description: Backbone Size:8200; Vector Backbone:pCAG-EGFP/RFP-int; Vector Types:Mammalian Expression, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18840295
Comments: A fragment of ~400 bases surrounding the miRNA insertion site was amplified from the first intron of the vector pUbC-miRNA-EGFP [36] with primers 5'-GCAATGACGCGATCGCTAATGCGGGAAAGCTCTTATTCGGGT-3' (forward) and 5'-AAGGCATGACGCGTTGTTGCGGCCGCCAGAGGTCCGGCGCCTGT-3' (reverse). miR-E2-4: GGTACCTGCTGTTGACAGTGAGCGAGAAGTGGTGTATCTAGAGATTATAGTGAAGCCACAGATGTATAATCTCTATACACCACTTCCTGCCTACTGCCTCGGACTTCAAGGGGAATTC

Proper citation: RRID:Addgene_19820 Copy   


  • RRID:Addgene_19825

    This resource has 1+ mentions.

http://www.addgene.org/19825

Genetic Insert: Scrambled miRNA
Vector Backbone Description: Backbone Size:6300; Vector Backbone:pCAG-RFP-int; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18840295
Comments: miR-Scr sequence: GGTACCTGCTGTTGACAGTGAGCGACGATGCTCTAATCGGTTCTATCAAGTGAAGCCACAGATGTTGATAGAACCTTAGAGCATCGCTGCCTACTGCCTCGGACTTCAAGGGGAATTC

Proper citation: RRID:Addgene_19825 Copy   


  • RRID:Addgene_19824

http://www.addgene.org/19824

Genetic Insert: miRNA
Vector Backbone Description: Backbone Size:6300; Vector Backbone:pCAG-RFP-int; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18840295
Comments: miR-E2-4 sequence: GGTACCTGCTGTTGACAGTGAGCGAGAAGTGGTGTATCTAGAGATTATAGTGAAGCCACAGATGTATAATCTCTATACACCACTTCCTGCCTACTGCCTCGGACTTCAAGGGGAATTC

Proper citation: RRID:Addgene_19824 Copy   


  • RRID:Addgene_19870

    This resource has 1+ mentions.

http://www.addgene.org/19870

Species: Homo sapiens
Genetic Insert: quaking homolog, KH domain RNA binding
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19870 Copy   


  • RRID:Addgene_19991

    This resource has 1+ mentions.

http://www.addgene.org/19991

Species: Homo sapiens
Genetic Insert: yfpsynhdat
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:6516; Vector Backbone:pcihygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12065645

Proper citation: RRID:Addgene_19991 Copy   


  • RRID:Addgene_19990

http://www.addgene.org/19990

Species: Homo sapiens
Genetic Insert: Dopamine transporter
Vector Backbone Description: Backbone Marker:Glaxowellcome,CLONTECH.; Backbone Size:5764; Vector Backbone:pcin4, pIREShygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10823899

Proper citation: RRID:Addgene_19990 Copy   


  • RRID:Addgene_19872

    This resource has 1+ mentions.

http://www.addgene.org/19872

Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 2
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19872 Copy   


  • RRID:Addgene_19993

    This resource has 1+ mentions.

http://www.addgene.org/19993

Species: Homo sapiens
Genetic Insert: Neurofibromatosis type I
Vector Backbone Description: Backbone Marker:clonetech; Backbone Size:5524; Vector Backbone:pGBT9; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8628317
Comments: The authors note that there is a mutation in the coding sequence: C3918T "This created a T to I change within the GAP domain of NF1. However, this change is outside of the conserved blocks within the GAP domain. This particular residue (1195 of NF1-GRD shown in figure 4 in the chapter by M.R. Kim and F. Tamanoi, chapter 6 in Neurofibromatosis type I from genotype to phenotype, editor by M. Upadhyaya and D. N. Cooper BIOS scientific publisher) is not conserved among different GAP proteins. Therefore, we believe that the amino acid change does not affect the GAP activity. In fact, we have used this construct for the wild-type GAP activity."

Proper citation: RRID:Addgene_19993 Copy   


  • RRID:Addgene_19994

    This resource has 1+ mentions.

http://www.addgene.org/19994

Species: Rattus norvegicus
Genetic Insert: mammalian target of rapamycin-E2419K
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17360675

Proper citation: RRID:Addgene_19994 Copy   


  • RRID:Addgene_19877

    This resource has 1+ mentions.

http://www.addgene.org/19877

Species: Homo sapiens
Genetic Insert: PABPC4
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Comments: Please note that the full PABPC4 sequence may differ from the depositor's sequence. Please see pFRT/TO/FLAG/HA-DEST PABPC4 (Plasmid #19882) for reference.

Proper citation: RRID:Addgene_19877 Copy   


  • RRID:Addgene_19879

    This resource has 1+ mentions.

http://www.addgene.org/19879

Species: Homo sapiens
Genetic Insert: Insulin-like growth factor 2 mRNA binding protein 3
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19879 Copy   


http://www.addgene.org/19912

Species: Homo sapiens
Genetic Insert: F-box and WD repeat domain containing 5 delta F
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3-myc3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18381890
Comments: F-Box Deletion Mutant (L45M mutation present but does not affect function)

Proper citation: RRID:Addgene_19912 Copy   


  • RRID:Addgene_19890

    This resource has 1+ mentions.

http://www.addgene.org/19890

Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 4
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19890 Copy   


  • RRID:Addgene_19882

    This resource has 1+ mentions.

http://www.addgene.org/19882

Species: Homo sapiens
Genetic Insert: Poly(A) binding protein, cytoplasmic 4
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19882 Copy   


  • RRID:Addgene_19885

    This resource has 1+ mentions.

http://www.addgene.org/19885

Species: Homo sapiens
Genetic Insert: Trinucleotide repeat containing 6C
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19885 Copy   


  • RRID:Addgene_19884

    This resource has 1+ mentions.

http://www.addgene.org/19884

Species: Homo sapiens
Genetic Insert: trinucleotide repeat containing 6B
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19884 Copy   


  • RRID:Addgene_19887

    This resource has 1+ mentions.

http://www.addgene.org/19887

Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 1
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19887 Copy   


http://www.addgene.org/19889

Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 3
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19889 Copy   


  • RRID:Addgene_19888

    This resource has 1+ mentions.

http://www.addgene.org/19888

Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 2
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19888 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X