Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:synthetic (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

30,517 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pMOD_C2517
 
Resource Report
Resource Website 		RRID:Addgene_91086 Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning) Synthetic Ampicillin PMID:28522548 Vector Backbone:pMOD_C0000; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:12:52 0
pMOD_C2516b
 
Resource Report
Resource Website 		RRID:Addgene_91085 Esp3I ccdb cassette for single gRNA spacer cloning Synthetic Ampicillin PMID:28522548 Vector Backbone:pMOD_C0000; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:12:52 0
pMOD_B3400
 
Resource Report
Resource Website 		RRID:Addgene_91080 TALE-VP64_2 backbone with Esp3I ccdb cassette for repeat cloning Synthetic Ampicillin PMID:28522548 Vector Backbone:pMOD_B2000; Vector Types:TALEN; Bacterial Resistance:Ampicillin 2026-08-29 01:12:52 0
pMOD_B2518
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_91075 Esp3I ccdb cassette for single gRNA spacer cloning Synthetic Ampicillin PMID:28522548 Please note: This plasmid may be prone to multimerization. This is not expected to impact the end function of the plasmid. Please refer to the Addgene Blog post on multimers for more information: https://blog.addgene.org/plasmids-101-dimers-and-multimers Vector Backbone:pMOD_B2000; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:12:52 1
pMOD_B2519
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_91076 Esp3I ccdb cassette for single gRNA spacer cloning Synthetic Ampicillin PMID:28522548 Vector Backbone:pMOD_B2000; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:12:52 1
pMOD_B2403
 
Resource Report
Resource Website 		RRID:Addgene_91071 SapI ccdb cassette for cloning multiple gRNA spacers with ribozyme spacers Synthetic Ampicillin PMID:28522548 Vector Backbone:pMOD_B2000; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:12:52 0
pMOD_B2312
 
Resource Report
Resource Website 		RRID:Addgene_91070 SapI ccdb cassette for cloning multiple gRNA spacers with tRNA spacers Synthetic Ampicillin PMID:28522548 Vector Backbone:pMOD_B2000; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:12:52 0
pDIRECT_10A
 
Resource Report
Resource Website 		RRID:Addgene_91207 35S:AtCas9 + AtU6:gRNA Synthetic Spectinomycin PMID:28522548 Vector Backbone:pTRANS_100; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin 2026-08-29 01:12:53 0
pJG370
 
Resource Report
Resource Website 		RRID:Addgene_91187 nAtCas9_D10A+gRNActrl+donor Synthetic Kanamycin PMID:28522548 Vector Backbone:pTRANS_201; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-29 01:12:53 0
pTC130
 
Resource Report
Resource Website 		RRID:Addgene_91178 TALENs targeting tomato ANT1 Synthetic Kanamycin PMID:28522548 Vector Backbone:pTC110; Vector Types:TALEN; Bacterial Resistance:Kanamycin 2026-08-29 01:12:53 0
pCRISPRi_Mxi1_yl
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_91248 Codon optimized dCas9-Mxi1 Synthetic Ampicillin PMID:28832943 Backbone Size:2623; Vector Backbone:pUC19; Vector Types:Yeast Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-29 01:12:54 2
pCRISPRi_Mxi1_yl_NHEJ
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_91249 Codon optimized dCas9-Mxi1 Synthetic Ampicillin PMID:28832943 Backbone Size:2623; Vector Backbone:pUC19; Vector Types:Yeast Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-29 01:12:54 1
pZac2.1 SV40-CMV-SaCas9-3xNLS
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_78601 SV40-CMV-SaCas9-3xNLS Synthetic Ampicillin PMID:26721686 Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:11:01 2
pCRII-Topo U6-SpAi9L-U6SpDMDL
 
Resource Report
Resource Website 		RRID:Addgene_78608 U6-SpAi9L-U6SpDMDL Synthetic Kanamycin PMID:26721686 Backbone Marker:Invitrogen; Vector Backbone:pCR blunt II TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-29 01:11:02 0
pCRII-Topo U6-SpAi9R-U6-SpDMDR
 
Resource Report
Resource Website 		RRID:Addgene_78609 U6-SpAi9R-U6-SpDMDR Synthetic Kanamycin PMID:26721686 Backbone Marker:Invitrogen; Vector Backbone:pCR blunt II TOPO; Vector Types:Unspecified; Bacterial Resistance:Kanamycin 2026-08-29 01:11:01 0
pZac2.1 U6-SaAi9L-U6-SaAi9R
 
Resource Report
Resource Website 		RRID:Addgene_78604 gRNAs for SaCas9 targeting Ai9 locus Synthetic Ampicillin PMID:26721686 Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:11:02 0
pZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
 
Resource Report
Resource Website 		RRID:Addgene_78606 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2 Synthetic Ampicillin PMID:26721686 gRNA targeting sequences: CAGTAATGTGTCATACCTTC; ATATAATAGAAATTATTCAT Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:11:01 0
pBW100ParsR
 
Resource Report
Resource Website 		RRID:Addgene_78635 J101-rbs32-arsR-t-ParsR Synthetic Kanamycin PMID:25030903 Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 01:11:04 0
pBW102ParsR-Amp32C
 
Resource Report
Resource Website 		RRID:Addgene_78637 30hrpR-32hrpS-t-hrpL-30gfp-t Synthetic Kanamycin PMID:25030903 Backbone Marker:Wang Lab; Vector Backbone:pBW100ParsR; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 01:11:02 0
pBW112pBAD-hrpV
 
Resource Report
Resource Website 		RRID:Addgene_78639 araC-PBAD Synthetic Kanamycin PMID:25030903 Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 01:11:02 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch