Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 90 showing 1781 ~ 1800 out of 30,517 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_91086

http://www.addgene.org/91086

Species: Synthetic
Genetic Insert: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
Vector Backbone Description: Vector Backbone:pMOD_C0000; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28522548

Proper citation: RRID:Addgene_91086 Copy   

    • RRID:Addgene_91085

http://www.addgene.org/91085

Species: Synthetic
Genetic Insert: Esp3I ccdb cassette for single gRNA spacer cloning
Vector Backbone Description: Vector Backbone:pMOD_C0000; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28522548

Proper citation: RRID:Addgene_91085 Copy   

    • RRID:Addgene_91080

http://www.addgene.org/91080

Species: Synthetic
Genetic Insert: TALE-VP64_2 backbone with Esp3I ccdb cassette for repeat cloning
Vector Backbone Description: Vector Backbone:pMOD_B2000; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28522548

Proper citation: RRID:Addgene_91080 Copy   

    • RRID:Addgene_91075

    This resource has 1+ mentions.

http://www.addgene.org/91075

Species: Synthetic
Genetic Insert: Esp3I ccdb cassette for single gRNA spacer cloning
Vector Backbone Description: Vector Backbone:pMOD_B2000; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28522548
Comments: Please note: This plasmid may be prone to multimerization. This is not expected to impact the end function of the plasmid. Please refer to the Addgene Blog post on multimers for more information: https://blog.addgene.org/plasmids-101-dimers-and-multimers

Proper citation: RRID:Addgene_91075 Copy   

    • RRID:Addgene_91076

    This resource has 1+ mentions.

http://www.addgene.org/91076

Species: Synthetic
Genetic Insert: Esp3I ccdb cassette for single gRNA spacer cloning
Vector Backbone Description: Vector Backbone:pMOD_B2000; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28522548

Proper citation: RRID:Addgene_91076 Copy   

    • RRID:Addgene_91071

http://www.addgene.org/91071

Species: Synthetic
Genetic Insert: SapI ccdb cassette for cloning multiple gRNA spacers with ribozyme spacers
Vector Backbone Description: Vector Backbone:pMOD_B2000; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28522548

Proper citation: RRID:Addgene_91071 Copy   

    • RRID:Addgene_91070

http://www.addgene.org/91070

Species: Synthetic
Genetic Insert: SapI ccdb cassette for cloning multiple gRNA spacers with tRNA spacers
Vector Backbone Description: Vector Backbone:pMOD_B2000; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28522548

Proper citation: RRID:Addgene_91070 Copy   

    • RRID:Addgene_91207

http://www.addgene.org/91207

Species: Synthetic
Genetic Insert: 35S:AtCas9 + AtU6:gRNA
Vector Backbone Description: Vector Backbone:pTRANS_100; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:28522548

Proper citation: RRID:Addgene_91207 Copy   

    • RRID:Addgene_91187

http://www.addgene.org/91187

Species: Synthetic
Genetic Insert: nAtCas9_D10A+gRNActrl+donor
Vector Backbone Description: Vector Backbone:pTRANS_201; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28522548

Proper citation: RRID:Addgene_91187 Copy   

    • RRID:Addgene_91178

http://www.addgene.org/91178

Species: Synthetic
Genetic Insert: TALENs targeting tomato ANT1
Vector Backbone Description: Vector Backbone:pTC110; Vector Types:TALEN; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28522548

Proper citation: RRID:Addgene_91178 Copy   

    • RRID:Addgene_91248

    This resource has 1+ mentions.

http://www.addgene.org/91248

Species: Synthetic
Genetic Insert: Codon optimized dCas9-Mxi1
Vector Backbone Description: Backbone Size:2623; Vector Backbone:pUC19; Vector Types:Yeast Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28832943

Proper citation: RRID:Addgene_91248 Copy   

    • RRID:Addgene_91249

    This resource has 1+ mentions.

http://www.addgene.org/91249

Species: Synthetic
Genetic Insert: Codon optimized dCas9-Mxi1
Vector Backbone Description: Backbone Size:2623; Vector Backbone:pUC19; Vector Types:Yeast Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28832943

Proper citation: RRID:Addgene_91249 Copy   

http://www.addgene.org/78601

Species: Synthetic
Genetic Insert: SV40-CMV-SaCas9-3xNLS
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26721686

Proper citation: RRID:Addgene_78601 Copy   

http://www.addgene.org/78608

Species: Synthetic
Genetic Insert: U6-SpAi9L-U6SpDMDL
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR blunt II TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26721686

Proper citation: RRID:Addgene_78608 Copy   

http://www.addgene.org/78609

Species: Synthetic
Genetic Insert: U6-SpAi9R-U6-SpDMDR
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR blunt II TOPO; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26721686

Proper citation: RRID:Addgene_78609 Copy   

http://www.addgene.org/78604

Species: Synthetic
Genetic Insert: gRNAs for SaCas9 targeting Ai9 locus
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26721686

Proper citation: RRID:Addgene_78604 Copy   

http://www.addgene.org/78606

Species: Synthetic
Genetic Insert: CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26721686
Comments: gRNA targeting sequences: CAGTAATGTGTCATACCTTC; ATATAATAGAAATTATTCAT

Proper citation: RRID:Addgene_78606 Copy   

    • RRID:Addgene_78635

http://www.addgene.org/78635

Species: Synthetic
Genetic Insert: J101-rbs32-arsR-t-ParsR
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903

Proper citation: RRID:Addgene_78635 Copy   

    • RRID:Addgene_78637

http://www.addgene.org/78637

Species: Synthetic
Genetic Insert: 30hrpR-32hrpS-t-hrpL-30gfp-t
Vector Backbone Description: Backbone Marker:Wang Lab; Vector Backbone:pBW100ParsR; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903

Proper citation: RRID:Addgene_78637 Copy   

    • RRID:Addgene_78639

http://www.addgene.org/78639

Species: Synthetic
Genetic Insert: araC-PBAD
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903

Proper citation: RRID:Addgene_78639 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch