Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: MKL1 T450A
Vector Backbone Description: Backbone Marker:S Rees et al., BioTechniques 1996; Backbone Size:5257; Vector Backbone:pCin4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18694962
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19843 Copy
Species: Homo sapiens
Genetic Insert: MKL1 S454A
Vector Backbone Description: Backbone Marker:S Rees et al., BioTechniques 1996; Backbone Size:5257; Vector Backbone:pCin4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18694962
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19844 Copy
Species: Homo sapiens
Genetic Insert: MKL1 S449A/T450A/S454A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6500; Vector Backbone:pRev TRE; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18694962
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19847 Copy
Species: Homo sapiens
Genetic Insert: MKL1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6500; Vector Backbone:pRev TRE; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18694962
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19846 Copy
Species: Homo sapiens
Genetic Insert: MKL1-N100 S449A/T450A/S454A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6500; Vector Backbone:pRev TRE; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18694962
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19849 Copy
Species: Homo sapiens
Genetic Insert: MKL1-N100
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6500; Vector Backbone:pRev TRE; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18694962
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19848 Copy
Species: Homo sapiens
Genetic Insert: c-myc
Vector Backbone Description: Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18786420
Comments: From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene.
Proper citation: RRID:Addgene_19775 Copy
Species: Homo sapiens
Genetic Insert: Klf4
Vector Backbone Description: Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18786420
Comments: From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene.
Proper citation: RRID:Addgene_19777 Copy
Genetic Insert: shRNA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18840295
Comments: Target sequence for shR-E2-2 - 5'-GCAATGCTGACGACTTTCAATGA
Proper citation: RRID:Addgene_19810 Copy
Species: Homo sapiens
Genetic Insert: NanogP8
Vector Backbone Description: Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18786420
Comments: From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene.
Proper citation: RRID:Addgene_19776 Copy
Species: Homo sapiens
Genetic Insert: Sox2
Vector Backbone Description: Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18786420
Comments: From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene.
Proper citation: RRID:Addgene_19779 Copy
Genetic Insert: shRNA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18840295
Comments: Target sequence for shR-E2-4 - 5'-GGAAGTGGTGTATAGAGATTATA
Proper citation: RRID:Addgene_19812 Copy
Genetic Insert: shRNA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18840295
Comments: Target sequence for shR-E2-7 - 5'-GAGGTTGACATGAGTAACATACA
Proper citation: RRID:Addgene_19814 Copy
Genetic Insert: shRNA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18840295
Comments: Target sequence for shR-E2-5 - 5'-GATATTGAACGGACCATTAATGA
Proper citation: RRID:Addgene_19813 Copy
Genetic Insert: empty vector
Vector Backbone Description: Backbone Size:8200; Vector Backbone:pZ/AP; Vector Types:Mammalian Expression, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18840295
Comments: The lacZ and the human placental alkaline phosphatase (AP) genes in the pZ/AP vector were replaced with EGFP, synthesized by PCR from pEGFP-N1 (Clontech), and RFP, synthesized by PCR from pDsRed2-C1 (Clontech), respectively. One cryptic start codon at the 5'UTR of the original AP gene that was not in frame was eliminated. These modifications produced a conditional vector for miRNA expression, pCAG-EGFP/RFP. A synthetic artificial intron was designed to contain typical intron splicing regulatory elements. This intron was placed 10 nt-downstream of the stop codon of the RFP gene to avoid NMD.
Proper citation: RRID:Addgene_19818 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8292; Vector Backbone:pGAD424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18722998
Proper citation: RRID:Addgene_19784 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:9033; Vector Backbone:pGAD424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18778253
Proper citation: RRID:Addgene_19783 Copy
Genetic Insert: Firefly Luciferase
Vector Backbone Description: Backbone Size:8072; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_19785 Copy
Species: Homo sapiens
Genetic Insert: NFRKB
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5400; Vector Backbone:BacPAK8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18922472
Proper citation: RRID:Addgene_19788 Copy
Genetic Insert: Scrambled miRNA
Vector Backbone Description: Backbone Size:8200; Vector Backbone:pCAG-EGFP/RFP-int; Vector Types:Mammalian Expression, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18840295
Comments: A fragment of ~400 bases surrounding the miRNA insertion site was amplified from the first intron of the vector pUbC-miRNA-EGFP [36] with primers 5'-GCAATGACGCGATCGCTAATGCGGGAAAGCTCTTATTCGGGT-3' (forward) and 5'-AAGGCATGACGCGTTGTTGCGGCCGCCAGAGGTCCGGCGCCTGT-3' (reverse).
miR-Scr:
GGTACCTGCTGTTGACAGTGAGCGACGATGCTCTAATCGGTTCTATCAAGTGAAGCCACAGATGTTGATAGAACCTTAGAGCATCGCTGCCTACTGCCTCGGACTTCAAGGGGAATTC
Proper citation: RRID:Addgene_19821 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
