Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
TAL3551 Resource Report Resource Website |
RRID:Addgene_47270 | ZebrafishCommunity-smyd1a-right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TCTCTGGTACCCCGCAGA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 01:53:57 | 0 | |
|
TAL3555 Resource Report Resource Website |
RRID:Addgene_47274 | ZebrafishCommunity-spermassociatedantigen7-right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TGATCGTGAACGGTTGGA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 01:53:57 | 0 | |
|
Cyprinodon variegatus cryaa Resource Report Resource Website |
RRID:Addgene_47664 | Alpha A-crystallin | Danio rerio | Ampicillin | PMID:22479631 | Backbone Marker:Novagen; Backbone Size:3716; Vector Backbone:pET-20b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 01:54:00 | 0 | ||
|
Danio rerio cryaa T147V Resource Report Resource Website |
RRID:Addgene_47628 | Alpha A-crystallin | Danio rerio | Ampicillin | PMID:22479631 | Backbone Marker:Novagen; Backbone Size:3716; Vector Backbone:pET-20b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Changed Theronine 147 to Valine | Addgene | 2026-10-10 01:54:00 | 0 | |
|
Danio rerio cryaba Resource Report Resource Website |
RRID:Addgene_47620 | Alpha Ba-crystallin | Danio rerio | Ampicillin | PMID:22479631 | Backbone Marker:Novagen; Backbone Size:3716; Vector Backbone:pET-20b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 01:54:00 | 0 | ||
|
Danio rerio cryaa C143S Resource Report Resource Website |
RRID:Addgene_47619 | Alpha A-crystallin | Danio rerio | Ampicillin | PMID:22479631 | Backbone Marker:Novagen; Backbone Size:3716; Vector Backbone:pET-20b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Cysteine 143 to Serine | Addgene | 2026-10-10 01:54:00 | 0 | |
|
pT7goldRNA Resource Report Resource Website |
RRID:Addgene_47930 | golden gRNA | Danio rerio | Ampicillin | PMID:23918387 | For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence GGTCTCTCGCAGGATGTTGC | Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 01:54:03 | 0 | |
|
pT7mitfagRNA Resource Report Resource Website |
RRID:Addgene_47931 | mitfa gRNA | Danio rerio | Ampicillin | PMID:23918387 | For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence GGTCTCTCGCAGGATGTTGC | Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 01:54:03 | 0 | |
|
pT7ddx19gRNA Resource Report Resource Website |
RRID:Addgene_47932 | ddx19 gRNA | Danio rerio | Ampicillin | PMID:23918387 | For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence GGCAACAGATTCGTGGGCCC | Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 01:54:03 | 0 | |
|
pME-fli1b Resource Report Resource Website |
RRID:Addgene_49019 | friend leukemia integration 1b | Danio rerio | Kanamycin | PMID:24036310 | Backbone Marker:invitrogen; Backbone Size:2515; Vector Backbone:pdonr221; Vector Types:gateway middle entry; Bacterial Resistance:Kanamycin | Addgene | 2026-10-10 01:54:13 | 0 | ||
|
Cs2+Etv5 S142D Resource Report Resource Website |
RRID:Addgene_49096 | Etv5 S142 D | Danio rerio | Ampicillin | PMID:20346941 | Backbone Marker:RZPD; Backbone Size:4095; Vector Backbone:pCs2+; Vector Types:Mammalian Expression, xenopus/avian/zebrafish; Bacterial Resistance:Ampicillin | S142D | Addgene | 2026-10-10 01:54:13 | 0 | |
|
hsp70l-loxP-mCherry-STOP-loxP-H2B-GFP_cryaa-cerulean Resource Report Resource Website 1+ mentions |
RRID:Addgene_24334 | H2B | Danio rerio | Ampicillin | PMID:19706417 | This plasmid was constructed using 1.5 kb of the hsp70l promoter. The floxed mCherry-STOP and H2b_GFP fragments were PCR amplified individually and sequentially cloned downstream of the hsp70l promoter. The mCherry-STOP cassette serves as a heat-shock induction marker prevents read-through translation of the H2B-GFP fusion protein, which is only expressed in cells that have undergone a Cre mediated excision event. cryaa-Cerulean was inserted downstream of HSB-GFP in the reverse orientation. *H2B has D26G and V119I mutations. According to the depositor, GFP expression from this construct was always nuclear so there is no reason to suspect that the mutations affect the function (nuclear localization) of the H2B fragment. | Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Worm Expression, Cre/Lox; Bacterial Resistance:Ampicillin | mCherry driven by an HSP70 promoterCerulean driven by a CrystalineA promoter* | Addgene | 2026-10-10 01:50:58 | 8 |
|
pENTR-fishRab8B[Q67L] Resource Report Resource Website |
RRID:Addgene_24908 | Rab8B | Danio rerio | Kanamycin | PMID:17574030 | This construct was generated by gene synthesis and is based on a reference sequence from 2007. Amino acids NE 178-179 are missing compared to current NCBI sequences. | Backbone Size:2500; Vector Backbone:pDONR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Changed Glutamine 67 to Leucine | Addgene | 2026-10-10 01:51:05 | 0 |
|
pENTR-fishRab8B Resource Report Resource Website |
RRID:Addgene_24907 | fishRab8B | Danio rerio | Kanamycin | PMID:17574030 | This construct was generated by gene synthesis and is based on a reference sequence from 2007. Amino acids NE 178-179 are missing compared to current NCBI sequences. | Backbone Size:2500; Vector Backbone:pDONR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Addgene | 2026-10-10 01:51:05 | 0 | |
|
475 p5EfliEBSbasP Resource Report Resource Website |
RRID:Addgene_26027 | fli1a intron 1 | Danio rerio | Kanamycin | PMID:23462469 | "p5E" refers to 5' entry clones flanked by L4-R1 There are a few mismatches between depositor's sequence and Addgene's sequence. The changes should not affect plasmid function. | Backbone Size:2858; Vector Backbone:p5E; Vector Types:; Bacterial Resistance:Kanamycin | Addgene | 2026-10-10 01:51:20 | 0 | |
|
776 pME-miR-126 Resource Report Resource Website |
RRID:Addgene_26033 | miR-126 | Danio rerio | Kanamycin | PMID:20364122 | The insert includes genomic sequence flanking the mature miR-126 sequence on chromosome 8 (miRBase accession number MI0001979, Zv8). There is a C->T mutation in the miR126. The mutation is probably due to a SNP and should not affect plasmid function. | Backbone Size:0; Vector Backbone:pME; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Addgene | 2026-10-10 01:51:20 | 0 | |
|
pCS2vegf165 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22417 | vegf | Danio rerio | Ampicillin | PMID:12110173 | Backbone Size:4000; Vector Backbone:pCS2+; Vector Types:zebrafish expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 01:50:32 | 1 | ||
|
Zahra76-77 Resource Report Resource Website |
RRID:Addgene_23959 | VSP | Danio rerio | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | T156R | Addgene | 2026-10-10 01:50:54 | 0 | ||
|
Zahra78-79 Resource Report Resource Website |
RRID:Addgene_23960 | VSP | Danio rerio | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R153Q T156R | Addgene | 2026-10-10 01:50:54 | 0 | ||
|
pEGFP-gfap(Intron1/5'/Exon1-zebrafish) Resource Report Resource Website 1+ mentions |
RRID:Addgene_39761 | zebrafish gfap promoter- EGFP | Danio rerio | Kanamycin | PMID:16765104 | Backbone Marker:Clontech; Backbone Size:4200; Vector Backbone:pEGFP-1; Vector Types:zebrafish expression; Bacterial Resistance:Kanamycin | Addgene | 2026-10-10 01:52:51 | 3 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
