Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
p063 pCS xTRPS1 delta N (M) Resource Report Resource Website |
RRID:Addgene_11036 | TRPS1 deltaN mut | Xenopus laevis | Ampicillin | PMID:11285235 | Backbone Size:4133; Vector Backbone:pCS105; Vector Types:mammalian, avian, and zebrafish; Bacterial Resistance:Ampicillin | aa806-1153 of xTRPS1. Two Cys residues in the GATA-type zinc finger were mutated to yield the sequence FGANAL instead of FCANCL. | 2026-07-25 12:34:59 | 0 | |
|
p064 pCS mTRPS1 P1 Resource Report Resource Website |
RRID:Addgene_11035 | TRPS1 P1 | Mus musculus | Ampicillin | PMID:11285235 | Please see Momeni et al (Nature Genetics 24: 71-74) to learn more about the patient mutation. | Backbone Size:4133; Vector Backbone:pCS105; Vector Types:xenopus, mammalian, avian, and zebrafish; Bacterial Resistance:Ampicillin | Truncation at aa338 to mimic C338X mutation found in patients. | 2026-07-25 12:34:59 | 0 |
|
H52-pUCM-hNGN2-inv Resource Report Resource Website |
RRID:Addgene_110492 | Neurogenin 2 | Homo sapiens | Ampicillin | Backbone Marker:custom; Backbone Size:6000; Vector Backbone:pUCM; Vector Types:Mammalian Expression, Cre/Lox, CRISPR, TALEN; Bacterial Resistance:Ampicillin | 2026-07-25 12:34:59 | 0 | |||
|
Yes-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_110497 | Yes | Homo sapiens | Kanamycin | Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:34:59 | 2 | |||
|
pLKO.1-blast shGAC Resource Report Resource Website |
RRID:Addgene_110410 | GLS glutaminase | Homo sapiens | Ampicillin | See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors. Plasmid grows more slowly than standard plasmids. | Backbone Marker:#26655; Backbone Size:6783; Vector Backbone:pLKO.1-blast; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:34:59 | 0 | ||
|
pcDNA5/FRT/TO/Flag-tGFP Resource Report Resource Website |
RRID:Addgene_110375 | turboGFP | Pontellina plumata | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5150; Vector Backbone:pcDNA5/FRT/TO/FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:34:59 | 0 | |||
|
tet-pLKO.puro_shHuR CDS Resource Report Resource Website 1+ mentions |
RRID:Addgene_110411 | ELAVL1 (HuR) | Homo sapiens | Ampicillin | See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors. Plasmid grows more slowly than standard plasmids. | Backbone Marker:#21915; Backbone Size:10633; Vector Backbone:Tet-pLKO-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:34:59 | 1 | ||
|
tet-pLKO.puro_shHuR 3UTR Resource Report Resource Website |
RRID:Addgene_110412 | ELAVL1 (HuR) | Homo sapiens | Ampicillin | See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors. Plasmid grows more slowly than standard plasmids. | Backbone Marker:#21915; Backbone Size:10633; Vector Backbone:Tet-pLKO-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:34:59 | 0 | ||
|
pcDNA3.1D V5-His-TOPO-HuR.wt Resource Report Resource Website |
RRID:Addgene_110417 | HuR (ELAVL1) | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5514; Vector Backbone:pcDNA3.1D/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:34:59 | 0 | |||
|
pcDNA3 HRPT2 136X Resource Report Resource Website |
RRID:Addgene_11049 | HRPT2 136X | Homo sapiens | Ampicillin | PMID:15632063 | Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGGATCCATGGCGGACGTGCTTAGCGT 3' and 5' CCGCTCGAGCTATGCTTCTGCTAAAACTTC 3' and ligated into pcDNA3 HRPT2 that had been digested with BamHI & XhoI (which removes full-length HRPT2, but leaves the flag tag at the N-terminus. See plasmid 11048 to learn how pcDNA3 HRPT2 was constructed). | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | truncation mutant with a stop codon introduced at aa136 | 2026-07-25 12:34:59 | 0 |
|
pcDNA3 HRPT2 Resource Report Resource Website |
RRID:Addgene_11048 | HRPT2 | Homo sapiens | Ampicillin | PMID:15632063 | Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGAATTCGGATCCACCATGGATTACAAGGATGACGACGATAAGGTCGACATGGCGGACGTGCTTAGCGT 3' and 5' CCGCTCGAGTCAGAATCTCAAGTGCGATTTATGCTT 3' | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:34:59 | 0 | |
|
p075 pCS xTRPS1 delN delC119 (M) Resource Report Resource Website |
RRID:Addgene_11045 | TRPS1 delN delC119 mut | Xenopus laevis | Ampicillin | PMID:11285235 | Can be expressed in cos cells, gives the correct sized product by in-vitro tranlation and can be expressed in xenopus embryos. | Backbone Size:4133; Vector Backbone:pCS105; Vector Types:xenopus, mammalian, avian, and zebrafish; Bacterial Resistance:Ampicillin | aa806-1153 of xTRPS1. Two Cys residues in the GATA-type zinc finger were mutated to yield the sequence FGANAL instead of FCANCL. | 2026-07-25 12:34:59 | 0 |
|
p077 pCS xTRPS1 (M) Resource Report Resource Website |
RRID:Addgene_11047 | TRPS1 mut | Xenopus laevis | Ampicillin | PMID:11285235 | Can be expressed in cos cells, does not give correct sized product by in-vitro translation, and cannot be expressed in xenopus embryos. | Backbone Size:4133; Vector Backbone:pCS105; Vector Types:mammalian, avian, and zebrafish; Bacterial Resistance:Ampicillin | Two Cys residues in the GATA-type zinc finger were mutated to yield the sequence FGANAL instead of FCANCL. | 2026-07-25 12:34:59 | 0 |
|
pcDNA3-FLAG-SOX4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_110360 | SOX4 | Homo sapiens | Ampicillin | PMID:16618720 | Backbone Marker:William Sellers; Vector Backbone:pcDNA3-Flag-FKHR; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | lacking 5' UTR | 2026-07-25 12:34:59 | 1 | |
|
p076 pCS xTRPS1 delN delC320 (M) Resource Report Resource Website |
RRID:Addgene_11046 | TRPS1 | Xenopus laevis | Ampicillin | PMID:11285235 | Backbone Size:4133; Vector Backbone:pCS105; Vector Types:mammalian, avian, and zebrafish; Bacterial Resistance:Ampicillin | aa806-952 of xTRPS1. Two Cys residues in the GATA-type zinc finger were mutated to yield the sequence FGANAL instead of FCANCL. | 2026-07-25 12:34:59 | 0 | |
|
pcDNA-HisA-HOXC6-2 Resource Report Resource Website |
RRID:Addgene_110365 | HOXC6 | Homo sapiens | Ampicillin | PMID:15637592 | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3-HISA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | short isoform | 2026-07-25 12:34:59 | 0 | |
|
p070 pCS xTRPS1 delN delC320 Resource Report Resource Website |
RRID:Addgene_11041 | TRPS1 | Xenopus laevis | Ampicillin | PMID:11285235 | Backbone Size:4133; Vector Backbone:pCS105; Vector Types:mammalian, avian, and zebrafish; Bacterial Resistance:Ampicillin | aa806-952 of xTRPS1 | 2026-07-25 12:34:59 | 0 | |
|
pcDNA-HisA-HOXC6-1 Resource Report Resource Website |
RRID:Addgene_110366 | HOXC6 | Homo sapiens | Ampicillin | PMID:15637592 | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3-HISA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | long isoform | 2026-07-25 12:34:59 | 0 | |
|
p068 pCS mTRPS1 (M) Resource Report Resource Website |
RRID:Addgene_11040 | TRPS1 mut | Mus musculus | Ampicillin | PMID:11285235 | Full coding + UTR of mTRPS1. Can be expressed in cos cell, xenopus embryos, and in vitro translation. | Backbone Size:4133; Vector Backbone:pCS105; Vector Types:xenopus, mammalian, avian, and zebrafish; Bacterial Resistance:Ampicillin | Two Cys residues at positions 917 and 920 in the GATA-type zinc finger were mutated to yield the sequence VGNAGG instead of VCNACG. | 2026-07-25 12:34:59 | 0 |
|
pX330.puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_110403 | Ampicillin | pX330 with puromycin resistance For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548. For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/ | Backbone Marker:#42230; Backbone Size:8506; Vector Backbone:pX330-U6-Chimeric_BB-CBh-hSpCas9; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:34:59 | 9 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
