Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
MP28444 – pFUSE2ss-aRD114_CHIg-mIgG2A Resource Report Resource Website |
RRID:Addgene_110555 | Anti-RD114 heavy chain | RD114 retrovirus | Bleocin (Zeocin) | PMID:31702531 | Backbone Marker:Invivogen; Backbone Size:3431; Vector Backbone:pFUSEss; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-12 02:15:03 | 0 | ||
|
pJM101(pUC18T-miniTn7T-gm-lacIq-Ptac) Resource Report Resource Website 1+ mentions |
RRID:Addgene_110558 | lacIq-Ptac | Other | Ampicillin | PMID:27613678 | Backbone Marker:Herbert Schweizer; Backbone Size:4569; Vector Backbone:pUC18T-miniTn7T-gm; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 1 | ||
|
pJM220 (pUC18T-miniTn7T-gm-rhaSR-PrhaBAD) Resource Report Resource Website 1+ mentions |
RRID:Addgene_110559 | rhaSR-PrhaBAD | Other | Ampicillin | PMID:27613678 | Backbone Marker:Herbert Schweizer; Backbone Size:4569; Vector Backbone:pUC18T-miniTn7T-gm; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 1 | ||
|
pET22b-ecDHFR-dCys Resource Report Resource Website |
RRID:Addgene_110541 | ecDHFR | E.coli | Ampicillin | PMID:24977791 | Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | C85 mutated to A85, C152 mutated to S152 | 2026-09-12 02:15:03 | 0 | |
|
pET22b-ecDHFR-dCys-L54C Resource Report Resource Website |
RRID:Addgene_110542 | ecDHFR | E.coli | Ampicillin | PMID:24977791 | Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | L54 mutated to C54, C85 mutated to A85, C152 mutated to S152 | 2026-09-12 02:15:03 | 0 | |
|
p175 Grg-1s HA Resource Report Resource Website |
RRID:Addgene_11064 | Grg1-S | Mus musculus | Ampicillin | PMID:12359720 | Backbone Marker:Roche Molecular Biochemicals; Backbone Size:5400; Vector Backbone:pMH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:04 | 0 | ||
|
pcDNA3 Rtf1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11060 | Rtf1 | Homo sapiens | Ampicillin | PMID:15632063 | Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CCCAAGCTTATGAAGAAACAGGCCAACA 3' and 5' CCGCTCGAGAATAAGCCCTCGTCGTTT 3' | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 1 | |
|
pACT5FVMF(f) Resource Report Resource Website |
RRID:Addgene_110549 | EGFP, FV LTRs | deleted foamy virus | Ampicillin | PMID:18209733 | Backbone Marker:Stratagene, La Jolla, CA; Backbone Size:5787; Vector Backbone:pBluescript II KS+; Vector Types:qPCR control for titering foamy virus; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 0 | ||
|
T1-araC-Pbad-D10A/H840A cas9 ABCD-pACYC-BB Resource Report Resource Website |
RRID:Addgene_110547 | dCas9 | Synthetic | Chloramphenicol | pIM2432 | Backbone Marker:Novagen/Agilent; Backbone Size:2412; Vector Backbone:pACYC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | D10A, H840A | 2026-09-12 02:15:03 | 0 | |
|
pGPD-luxAB(HIS) Resource Report Resource Website 1+ mentions |
RRID:Addgene_1106 | bacterial luciferase | bacteria | Ampicillin | PMID:7984243 | His as a selectable marker | Backbone Size:0; Vector Backbone:unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | n/a | 2026-09-12 02:15:03 | 3 |
|
pRS316Nab3-11 Resource Report Resource Website |
RRID:Addgene_110535 | NAB3 | Saccharomyces cerevisiae | Ampicillin | PMID:22564898 | Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | two missense mutations creating Nab3-11 | 2026-09-12 02:15:03 | 0 | |
|
pRS316Nab3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_110533 | NAB3 | Saccharomyces cerevisiae | Ampicillin | PMID:22564898 | Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 1 | ||
|
pRS315Nab3Q->E Resource Report Resource Website |
RRID:Addgene_110538 | NAB3 | Saccharomyces cerevisiae | Ampicillin | PMID:26954508 | Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Q to E mutations in Nab3 low complexity domain | 2026-09-12 02:15:03 | 0 | |
|
pMEV4 Resource Report Resource Website |
RRID:Addgene_110539 | Ampicillin | PMID:26886063 | Vector Backbone:pAW42; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 0 | ||||
|
pBTK300 Resource Report Resource Website |
RRID:Addgene_110592 | rpoC | Synthetic | Chloramphenicol | PMID:29608282 | Vector Backbone:ColE1; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | 2026-09-12 02:15:03 | 0 | ||
|
pBTK401 Resource Report Resource Website |
RRID:Addgene_110597 | mRFP dropout (RSF1010 origin) | Synthetic | Ampicillin | PMID:29608282 | Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 0 | ||
|
cfSBFP2-N Resource Report Resource Website |
RRID:Addgene_110633 | cfSBFP2 | Synthetic | Kanamycin | Please note that although the sequencing software identifies the protein as a mEmerald variant, we have confirmed the the sequence is cfSBFP2 (C48S/C70M). | Backbone Marker:Clontech; Vector Backbone:EGFP-N1; Vector Types:; Bacterial Resistance:Kanamycin | Cys48Ser/Cys70Met | 2026-09-12 02:15:04 | 0 | |
|
pBTK402 Resource Report Resource Website 1+ mentions |
RRID:Addgene_110598 | mRFP dropout (RSF1010 origin) | Synthetic | Kanamycin | PMID:29608282 | Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-09-12 02:15:03 | 1 | ||
|
cfSYFP2-N Resource Report Resource Website |
RRID:Addgene_110631 | cfSYFP2-N | Synthetic | Kanamycin | Please note that although the sequencing software identifies the protein as a mEmerald/Topaz YFP variant, we have confirmed the the sequence is SYFP2 (C48S/C70M). | Vector Backbone:SYFP2-N; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Cys48Ser and Cys70/Met | 2026-09-12 02:15:04 | 0 | |
|
PCDHB10-mCherry Resource Report Resource Website |
RRID:Addgene_110516 | PCDHB10 | Homo sapiens | Kanamycin | Backbone Size:4700; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:15:03 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
