Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 89 showing 1761 ~ 1780 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/110555

Species: RD114 retrovirus
Genetic Insert: Anti-RD114 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:3431; Vector Backbone:pFUSEss; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:31702531

Proper citation: RRID:Addgene_110555 Copy   


http://www.addgene.org/110558

Species: Other
Genetic Insert: lacIq-Ptac
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Backbone Size:4569; Vector Backbone:pUC18T-miniTn7T-gm; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27613678

Proper citation: RRID:Addgene_110558 Copy   


http://www.addgene.org/110559

Species: Other
Genetic Insert: rhaSR-PrhaBAD
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Backbone Size:4569; Vector Backbone:pUC18T-miniTn7T-gm; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27613678

Proper citation: RRID:Addgene_110559 Copy   


  • RRID:Addgene_110541

http://www.addgene.org/110541

Species: E.coli
Genetic Insert: ecDHFR
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24977791

Proper citation: RRID:Addgene_110541 Copy   


http://www.addgene.org/110542

Species: E.coli
Genetic Insert: ecDHFR
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24977791

Proper citation: RRID:Addgene_110542 Copy   


  • RRID:Addgene_11064

http://www.addgene.org/11064

Species: Mus musculus
Genetic Insert: Grg1-S
Vector Backbone Description: Backbone Marker:Roche Molecular Biochemicals; Backbone Size:5400; Vector Backbone:pMH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12359720

Proper citation: RRID:Addgene_11064 Copy   


  • RRID:Addgene_11060

    This resource has 1+ mentions.

http://www.addgene.org/11060

Species: Homo sapiens
Genetic Insert: Rtf1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CCCAAGCTTATGAAGAAACAGGCCAACA 3' and 5' CCGCTCGAGAATAAGCCCTCGTCGTTT 3'

Proper citation: RRID:Addgene_11060 Copy   


  • RRID:Addgene_110549

http://www.addgene.org/110549

Species: deleted foamy virus
Genetic Insert: EGFP, FV LTRs
Vector Backbone Description: Backbone Marker:Stratagene, La Jolla, CA; Backbone Size:5787; Vector Backbone:pBluescript II KS+; Vector Types:qPCR control for titering foamy virus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18209733

Proper citation: RRID:Addgene_110549 Copy   


http://www.addgene.org/110547

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Backbone Marker:Novagen/Agilent; Backbone Size:2412; Vector Backbone:pACYC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: pIM2432

Proper citation: RRID:Addgene_110547 Copy   


  • RRID:Addgene_1106

    This resource has 1+ mentions.

http://www.addgene.org/1106

Species: bacteria
Genetic Insert: bacterial luciferase
Vector Backbone Description: Backbone Size:0; Vector Backbone:unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7984243
Comments: His as a selectable marker

Proper citation: RRID:Addgene_1106 Copy   


  • RRID:Addgene_110535

http://www.addgene.org/110535

Species: Saccharomyces cerevisiae
Genetic Insert: NAB3
Vector Backbone Description: Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22564898

Proper citation: RRID:Addgene_110535 Copy   


  • RRID:Addgene_110533

    This resource has 1+ mentions.

http://www.addgene.org/110533

Species: Saccharomyces cerevisiae
Genetic Insert: NAB3
Vector Backbone Description: Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22564898

Proper citation: RRID:Addgene_110533 Copy   


  • RRID:Addgene_110538

http://www.addgene.org/110538

Species: Saccharomyces cerevisiae
Genetic Insert: NAB3
Vector Backbone Description: Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26954508

Proper citation: RRID:Addgene_110538 Copy   


  • RRID:Addgene_110539

http://www.addgene.org/110539

Vector Backbone Description: Vector Backbone:pAW42; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26886063

Proper citation: RRID:Addgene_110539 Copy   


  • RRID:Addgene_110592

http://www.addgene.org/110592

Species: Synthetic
Genetic Insert: rpoC
Vector Backbone Description: Vector Backbone:ColE1; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29608282

Proper citation: RRID:Addgene_110592 Copy   


  • RRID:Addgene_110597

http://www.addgene.org/110597

Species: Synthetic
Genetic Insert: mRFP dropout (RSF1010 origin)
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29608282

Proper citation: RRID:Addgene_110597 Copy   


  • RRID:Addgene_110633

http://www.addgene.org/110633

Species: Synthetic
Genetic Insert: cfSBFP2
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:EGFP-N1; Vector Types:; Bacterial Resistance:Kanamycin
Comments: Please note that although the sequencing software identifies the protein as a mEmerald variant, we have confirmed the the sequence is cfSBFP2 (C48S/C70M).

Proper citation: RRID:Addgene_110633 Copy   


  • RRID:Addgene_110598

    This resource has 1+ mentions.

http://www.addgene.org/110598

Species: Synthetic
Genetic Insert: mRFP dropout (RSF1010 origin)
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29608282

Proper citation: RRID:Addgene_110598 Copy   


  • RRID:Addgene_110631

http://www.addgene.org/110631

Species: Synthetic
Genetic Insert: cfSYFP2-N
Vector Backbone Description: Vector Backbone:SYFP2-N; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Please note that although the sequencing software identifies the protein as a mEmerald/Topaz YFP variant, we have confirmed the the sequence is SYFP2 (C48S/C70M).

Proper citation: RRID:Addgene_110631 Copy   


  • RRID:Addgene_110516

http://www.addgene.org/110516

Species: Homo sapiens
Genetic Insert: PCDHB10
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_110516 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X