Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species:
Genetic Insert: miR30
Vector Backbone Description: Backbone Size:7500; Vector Backbone:MSCV2.2 with WPRE cloned into ClaI site is the base vector; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: See FLIP vector protocols (PDF from this page) for more information.
This vector contains the SwaI site for cloning multiple shRNAs into a single vector.
Proper citation: RRID:Addgene_22699 Copy
Species:
Genetic Insert: Lox71-MCS-Lox2272
Vector Backbone Description: Backbone Size:2905; Vector Backbone:pBluescript KS+; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Please note that the plasmid names and lox sites have been corrected since publication.
Proper citation: RRID:Addgene_22732 Copy
Species:
Genetic Insert: Lox66-pU(delta)TK-EM7Neo-Lox2272
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2969; Vector Backbone:pBluescript KS+; Vector Types:Cre/Lox, BAC recombineering; Bacterial Resistance:Ampicillin
References:
Comments: Please note that the plasmid names and lox sites have been corrected since publication.
Proper citation: RRID:Addgene_22733 Copy
Species: Homo sapiens
Genetic Insert: miR-31
Vector Backbone Description: Backbone Marker:Weinberg lab (Addgene#:1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: Useful for stable suppression of miR-31 function.
Original sponge backbone modifed from Ebert et al., Nat. Methods (2007); miR-31 construct and stable design are novel
Repeated sequence is: AGGCAAGACGAGGCATAGCT
*Addgene sequencing found at least partial EGFP upstream of the sponge. We do not know if the EGFP is functional or a side-product of the cloning.
Proper citation: RRID:Addgene_22694 Copy
Species: Drosophila melanogaster
Genetic Insert: micro-RNA-92b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5348; Vector Backbone:pAc5.1A; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22709 Copy
Species: Homo sapiens
Genetic Insert: Egg laying Nine - 2 (EglN2)
Vector Backbone Description: Backbone Size:5145; Vector Backbone:pBabe-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22705 Copy
Species: Mus musculus
Genetic Insert: Inhibitor of DNA binding 1
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid is identical to Plasmid 22664: pId1-B.IRES-Venus.
Proper citation: RRID:Addgene_22668 Copy
Species: Drosophila melanogaster
Genetic Insert: micro RNA 6-1, micro RNA 6-2, micro RNA 6-3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5348; Vector Backbone:pAc5.1A; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22789 Copy
Species:
Genetic Insert: NeoR
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22669 Copy
Species: Homo sapiens
Genetic Insert: cyclin D1
Vector Backbone Description: Backbone Size:5536; Vector Backbone:pBabe-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22703 Copy
Species:
Genetic Insert: IRES-Venus
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22665 Copy
Species:
Genetic Insert: A DNA containing CHLI fragment
Vector Backbone Description: Backbone Size:5702; Vector Backbone:pBluescript SK+ II (original backbone); Vector Types:RNAi, Arabidopsis VIGS vector; Bacterial Resistance:Ampicillin
References:
Comments: Has a 360-bp CHLI insert as a visual marker for silencing cloned into A-DNA vector. magnesium chelatase subunit I.
--Must be bombarded with appropriate B DNA for systemic infection
Proper citation: RRID:Addgene_22786 Copy
Species:
Genetic Insert: B DNA
Vector Backbone Description: Backbone Size:6854; Vector Backbone:pBluescript SK+ II (original backbone); Vector Types:RNAi, Arabidopsis VIGS vector; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22787 Copy
Species: Mus musculus
Genetic Insert: Inhibitor of DNA binding 1
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid is identical to pId1-IRES-Venus (Plasmid #22663).
Proper citation: RRID:Addgene_22667 Copy
Species: Homo sapiens
Genetic Insert: PAK binding domain
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pYpet-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22781 Copy
Species: Homo sapiens
Genetic Insert: Rac1 (wt)
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCyPet-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22782 Copy
Species: Homo sapiens
Genetic Insert: Rac1 (Q61L)
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCyPet-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22783 Copy
Species: Homo sapiens
Genetic Insert: Rac1 (T17N)
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCyPet-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22784 Copy
Species: A. victoria
Genetic Insert: Ypet
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pYpet-C1-Control; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22780 Copy
Species: Mus musculus
Genetic Insert: Myelin Transcription Factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3948; Vector Backbone:pCRII; Vector Types:cloning vector TT/AA; Bacterial Resistance:Ampicillin
References:
Comments: The murine Myt1 cDNA (6 zinc fingers) had 3 base mutations within the coding region (bp 806, 837 and 4344). These sites were corrected using Stratagene QuickChang Site-Directed mutagenesis. The Myt1 was sequenced after the mutagenesis and found to be correct. There is still one mutation in the 5' UTR at bp 529 (START codon is bp 532)
Proper citation: RRID:Addgene_22713 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
